rs1554844950

Variant names:

• chr10-110835884-T-TGGCCGAGGAGGGCCTCAAGGAGACCGAGGG
• rs1554844950
• NM_001134363.3:c.3594_3623dupCGAGGAGGGCCTCAAGGAGACCGAGGGGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001134363.3(RBM20):​c.3594_3623dupCGAGGAGGGCCTCAAGGAGACCGAGGGGGC​(p.Ala1208_Asp1209insGluGluGlyLeuLysGluThrGluGlyAla) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.00000657 in 152,206 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A1208A) has been classified as Likely benign.

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
• Consequence: RBM20 NM_001134363.3 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 4.03
• Publications: 0 publications found

Genes affected

RBM20 (HGNC:27424): (RNA binding motif protein 20) This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]

RBM20 Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• dilated cardiomyopathy 1DD

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hypertrophic cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001134363.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001134363.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RBM20	NM_001134363.3	MANE Select	c.3594_3623dupCGAGGAGGGCCTCAAGGAGACCGAGGGGGC	p.Ala1208_Asp1209insGluGluGlyLeuLysGluThrGluGlyAla	disruptive_inframe_insertion	Exon 14 of 14	NP_001127835.2	Q5T481

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RBM20	ENST00000369519.4	TSL:1 MANE Select	c.3594_3623dupCGAGGAGGGCCTCAAGGAGACCGAGGGGGC	p.Ala1208_Asp1209insGluGluGlyLeuLysGluThrGluGlyAla	disruptive_inframe_insertion	Exon 14 of 14	ENSP00000358532.3	Q5T481
	RBM20	ENST00000961386.1		c.3624_3653dupCGAGGAGGGCCTCAAGGAGACCGAGGGGGC	p.Ala1218_Asp1219insGluGluGlyLeuLysGluThrGluGlyAla	disruptive_inframe_insertion	Exon 14 of 14	ENSP00000631445.1
	RBM20	ENST00000718239.1		c.3594_3623dupCGAGGAGGGCCTCAAGGAGACCGAGGGGGC	p.Ala1208_Asp1209insGluGluGlyLeuLysGluThrGluGlyAla	disruptive_inframe_insertion	Exon 14 of 14	ENSP00000520684.1	Q5T481

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152206 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 30

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152206 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74356

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000241 AC: 1 AN: 41456

American (AMR) AF: 0.00 AC: 0 AN: 15284

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5196

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10616

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68032

Other (OTH) AF: 0.00 AC: 0 AN: 2090

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Cardiovascular phenotype (1)
-	1	-	Dilated cardiomyopathy 1DD (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.0
Mutation Taster		=70/30	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554844950; hg19: chr10-112595642;