rs1554898257

Variant names:

• chr8-144513323-CACAGCCCGCACATCTGGCCGGT-C
• rs1554898257
• NM_004260.4:c.2336_2357delACCGGCCAGATGTGCGGGCTGT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_004260.4(RECQL4):​c.2336_2357delACCGGCCAGATGTGCGGGCTGT​(p.Asp779GlyfsTer57) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: RECQL4 NM_004260.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 5.80
• Publications: 1 publications found

Genes affected

RECQL4 (HGNC:9949): (RecQ like helicase 4) The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]

RECQL4 Gene-Disease associations (from GenCC):

• Baller-Gerold syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, G2P, Orphanet
• Rothmund-Thomson syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Rothmund-Thomson syndrome type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, G2P
• osteosarcoma

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
• rapadilino syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp

ENSG00000265393 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-144513323-CACAGCCCGCACATCTGGCCGGT-C is Pathogenic according to our data. Variant chr8-144513323-CACAGCCCGCACATCTGGCCGGT-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 559922.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RECQL4	NM_004260.4	c.2336_2357delACCGGCCAGATGTGCGGGCTGT	p.Asp779GlyfsTer57	frameshift_variant	Exon 14 of 21	ENST00000617875.6	NP_004251.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RECQL4	ENST00000617875.6	c.2336_2357delACCGGCCAGATGTGCGGGCTGT	p.Asp779GlyfsTer57	frameshift_variant	Exon 14 of 21	1	NM_004260.4	ENSP00000482313.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Rothmund-Thomson syndrome Pathogenic:1

Jun 21, 2016

Equipe Genetique des Anomalies du Developpement, Université de Bourgogne

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554898257; hg19: chr8-145738706;