rs1554930637

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PM1PM2PM4PP3PP5

The NM_000141.5(FGFR2):​c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC​(p.His287_Pro307del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 33)

Consequence

FGFR2
NM_000141.5 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 9.99
Variant links:
Genes affected
FGFR2 (HGNC:3689): (fibroblast growth factor receptor 2) The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PM1
In a strand (size 6) in uniprot entity FGFR2_HUMAN there are 10 pathogenic changes around while only 0 benign (100%) in NM_000141.5
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000141.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 10-121519996-AGGGCAGCCCGTCGGGCCCGTATTTACTGCCGTTCTTTTCCACGTGCTTGATCCACTGGATGTG-A is Pathogenic according to our data. Variant chr10-121519996-AGGGCAGCCCGTCGGGCCCGTATTTACTGCCGTTCTTTTCCACGTGCTTGATCCACTGGATGTG-A is described in ClinVar as [Pathogenic]. Clinvar id is 29852.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
FGFR2NM_000141.5 linkc.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His287_Pro307del conservative_inframe_deletion Exon 7 of 18 ENST00000358487.10 NP_000132.3 P21802-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
FGFR2ENST00000358487.10 linkc.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His287_Pro307del conservative_inframe_deletion Exon 7 of 18 1 NM_000141.5 ENSP00000351276.6 P21802-1
FGFR2ENST00000457416.7 linkc.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His287_Pro307del conservative_inframe_deletion Exon 7 of 18 1 ENSP00000410294.2 P21802-3
FGFR2ENST00000369056.5 linkc.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His287_Pro307del conservative_inframe_deletion Exon 6 of 17 1 ENSP00000358052.1 P21802-17
FGFR2ENST00000369058.7 linkc.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His287_Pro307del conservative_inframe_deletion Exon 7 of 17 1 ENSP00000358054.3 A0A5S6RJB7
FGFR2ENST00000613048.4 linkc.592_654delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His198_Pro218del conservative_inframe_deletion Exon 6 of 17 5 ENSP00000484154.1 D2CGD1
FGFR2ENST00000369059.5 linkc.514_576delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His172_Pro192del conservative_inframe_deletion Exon 5 of 16 5 ENSP00000358055.1 E7EVR7
FGFR2ENST00000360144.7 linkc.592_654delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His198_Pro218del conservative_inframe_deletion Exon 6 of 17 2 ENSP00000353262.3 P21802-22
FGFR2ENST00000478859.5 linkc.175_237delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC p.His59_Pro79del conservative_inframe_deletion Exon 6 of 17 1 ENSP00000474011.1 S4R381
FGFR2ENST00000369061.8 linkc.749-4740_749-4678delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC intron_variant Intron 5 of 14 1 ENSP00000358057.4 P21802-23
FGFR2ENST00000604236.5 linkn.514_576delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC non_coding_transcript_exon_variant Exon 5 of 17 1 ENSP00000474109.1 S4R3B2

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Beare-Stevenson cutis gyrata syndrome Pathogenic:1
Aug 01, 2009
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554930637; hg19: chr10-123279510; API