rs1554931773

Variant names:

• chr11-22262189-AGTTTGTAAATTTTTACTCATCCT-A
• rs1554931773
• NM_213599.3:c.1693_1715delTTTGTAAATTTTTACTCATCCTG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_213599.3(ANO5):​c.1693_1715delTTTGTAAATTTTTACTCATCCTG​(p.Phe565LeufsTer7) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. F565F) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay. The gene ANO5 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ANO5 NM_213599.3 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:3
• Conservation: PhyloP100: 9.99
• Publications: 0 publications found

Genes affected

ANO5 (HGNC:27337): (anoctamin 5) This gene encodes a member of the anoctamin family of transmembrane proteins. The encoded protein is likely a calcium activated chloride channel. Mutations in this gene have been associated with gnathodiaphyseal dysplasia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]

ANO5 Gene-Disease associations (from GenCC):

• gnathodiaphyseal dysplasia

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), G2P, Orphanet
• autosomal recessive limb-girdle muscular dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• autosomal recessive limb-girdle muscular dystrophy type 2L

  Inheritance: AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet
• Miyoshi muscular dystrophy 3

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000255372 (HGNC:):

ACMG classification

Specifications for ANO5 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_213599.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ANO5	NM_213599.3	MANE Select	c.1693_1715delTTTGTAAATTTTTACTCATCCTG	p.Phe565LeufsTer7	frameshift	Exon 16 of 22	NP_998764.1	Q75V66
	ANO5	NM_001142649.2		c.1690_1712delTTTGTAAATTTTTACTCATCCTG	p.Phe564LeufsTer7	frameshift	Exon 16 of 22	NP_001136121.1
	ANO5	NM_001410963.1		c.1651_1673delTTTGTAAATTTTTACTCATCCTG	p.Phe551LeufsTer7	frameshift	Exon 15 of 21	NP_001397892.1	A0A804HL91

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ANO5	ENST00000324559.9	TSL:1 MANE Select	c.1693_1715delTTTGTAAATTTTTACTCATCCTG	p.Phe565LeufsTer7	frameshift	Exon 16 of 22	ENSP00000315371.9	Q75V66
	ANO5	ENST00000682341.1		c.1651_1673delTTTGTAAATTTTTACTCATCCTG	p.Phe551LeufsTer7	frameshift	Exon 15 of 21	ENSP00000508251.1	A0A804HL91
	ANO5	ENST00000684663.1		c.1648_1670delTTTGTAAATTTTTACTCATCCTG	p.Phe550LeufsTer7	frameshift	Exon 15 of 21	ENSP00000508009.1	A0A804HKP2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Autosomal recessive limb-girdle muscular dystrophy type 2L (1)
-	1	-	Gnathodiaphyseal dysplasia (1)
-	1	-	Miyoshi muscular dystrophy 3 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554931773; hg19: chr11-22283735;