rs1554984826

Variant names:

• chr11-66705356-T-TGATTCCTCCAGCCGGGCCCGCCGC
• rs1554984826
• NM_006946.4:c.1896_1919dupGCGGCGGGCCCGGCTGGAGGAATC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_006946.4(SPTBN2):​c.1896_1919dupGCGGCGGGCCCGGCTGGAGGAATC​(p.Ser640_Arg641insArgArgAlaArgLeuGluGluSer) variant causes a disruptive inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: SPTBN2 NM_006946.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.83
• Publications: 0 publications found

Genes affected

SPTBN2 (HGNC:11276): (spectrin beta, non-erythrocytic 2) Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]

SPTBN2 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 5

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, ClinGen, G2P, Orphanet, Labcorp Genetics (formerly Invitae), Illumina
• autosomal recessive spinocerebellar ataxia 14

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, G2P, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006946.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006946.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPTBN2	NM_006946.4	MANE Select	c.1896_1919dupGCGGCGGGCCCGGCTGGAGGAATC	p.Ser640_Arg641insArgArgAlaArgLeuGluGluSer	disruptive_inframe_insertion	Exon 15 of 38	NP_008877.2	O15020-1
	SPTBN2	NM_001411025.1		c.1917_1940dupGCGGCGGGCCCGGCTGGAGGAATC	p.Ser647_Arg648insArgArgAlaArgLeuGluGluSer	disruptive_inframe_insertion	Exon 13 of 36	NP_001397954.1	A0A087WYQ1
	SPTBN2	NM_001437541.1		c.1896_1919dupGCGGCGGGCCCGGCTGGAGGAATC	p.Ser640_Arg641insArgArgAlaArgLeuGluGluSer	disruptive_inframe_insertion	Exon 14 of 37	NP_001424470.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPTBN2	ENST00000533211.6	TSL:5 MANE Select	c.1896_1919dupGCGGCGGGCCCGGCTGGAGGAATC	p.Ser640_Arg641insArgArgAlaArgLeuGluGluSer	disruptive_inframe_insertion	Exon 15 of 38	ENSP00000432568.1	O15020-1
	SPTBN2	ENST00000309996.7	TSL:1	c.1896_1919dupGCGGCGGGCCCGGCTGGAGGAATC	p.Ser640_Arg641insArgArgAlaArgLeuGluGluSer	disruptive_inframe_insertion	Exon 14 of 37	ENSP00000311489.2	O15020-1
	SPTBN2	ENST00000617502.5	TSL:5	c.1917_1940dupGCGGCGGGCCCGGCTGGAGGAATC	p.Ser647_Arg648insArgArgAlaArgLeuGluGluSer	disruptive_inframe_insertion	Exon 13 of 36	ENSP00000482000.2	A0A087WYQ1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 36

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554984826; hg19: chr11-66472827;