rs1555072063

Positions:

• chr11-108252010-AAGTGCCTCCAATTCTTCACAGGTAATTTAAGTTCATTAGCATGCTGCTGTTTTTTTTGTTTGTTTTATCAGGCTCTCTCCACTTATTTGATGCCAGATGGCTTTATTTTAT-A

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The NM_000051.4(ATM):​c.1783_1802+91del variant causes a splice donor, splice donor 5th base, coding sequence, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E594E) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM NM_000051.4 splice_donor, splice_donor_5th_base, coding_sequence, intron
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 5.43

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.021153636 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-108252010-AAGTGCCTCCAATTCTTCACAGGTAATTTAAGTTCATTAGCATGCTGCTGTTTTTTTTGTTTGTTTTATCAGGCTCTCTCCACTTATTTGATGCCAGATGGCTTTATTTTAT-A is Pathogenic according to our data. Variant chr11-108252010-AAGTGCCTCCAATTCTTCACAGGTAATTTAAGTTCATTAGCATGCTGCTGTTTTTTTTGTTTGTTTTATCAGGCTCTCTCCACTTATTTGATGCCAGATGGCTTTATTTTAT-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 407614.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
ATM	NM_000051.4	c.1783_1802+91del		splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	11/63	ENST00000675843.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
ATM	ENST00000675843.1	c.1783_1802+91del		splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	11/63		NM_000051.4	P1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	Ambry Genetics	Jun 05, 2023	The c.1783_1802+91DEL111 intronic variant begins 91 nucleotides after coding exon 10 in the ATM gene. This variant results from a deletion of 111 nucleotides at positions c.1783 to c.1802+91. This deletion encompasses the native splice donor site. This variant was identified in 1/177 individuals with pancreatic ductal adenocarcinoma undergoing multi-gene panel testing (Cremin C et al. Cancer Med, 2020 06;9:4004-4013). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In silico splice site analysis predicts that this alteration will weaken the native splice donor site; however, direct evidence is insufficient at this time (Ambry internal data). Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	May 23, 2023	This variant deletes 111 nucleotides in exon 11/intron 11 splice junction of the ATM gene, removing the splice donor site. Aberrant splicing is expected to result in a premature translation stop signal and an absent or non-functional protein product, but this has not been tested experimentally. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of ATM function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Likely Pathogenic. -

Ataxia-telangiectasia syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Invitae

Oct 24, 2023

This variant results in the deletion of part of exon 11 (c.1783_1802+91del) of the ATM gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in ATM are known to be pathogenic (PMID: 23807571, 25614872). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with pancreatic ductal adenocarcinoma (PMID: 32255556). ClinVar contains an entry for this variant (Variation ID: 407614). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555072063; hg19: chr11-108122737;