rs1555163115

Variant names:

• chr11-64804438-GCTTGATGGCGCTCGAGTTGAT-G
• rs1555163115
• NM_001370259.2:c.1708_1728delATCAACTCGAGCGCCATCAAG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_001370259.2(MEN1):​c.1708_1728delATCAACTCGAGCGCCATCAAG​(p.Ile570_Lys576del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. I570I) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MEN1 NM_001370259.2 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 7.88
• Publications: 0 publications found

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

MEN1 Gene-Disease associations (from GenCC):

• multiple endocrine neoplasia type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• familial isolated hyperparathyroidism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• pituitary gigantism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001370259.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-64804438-GCTTGATGGCGCTCGAGTTGAT-G is Pathogenic according to our data. Variant chr11-64804438-GCTTGATGGCGCTCGAGTTGAT-G is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 428068.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001370259.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MEN1	NM_001370259.2	MANE Select	c.1708_1728delATCAACTCGAGCGCCATCAAG	p.Ile570_Lys576del	conservative_inframe_deletion	Exon 10 of 10	NP_001357188.2	O00255-2
	MEN1	NM_001407150.1		c.1849_1869delATCAACTCGAGCGCCATCAAG	p.Ile617_Lys623del	conservative_inframe_deletion	Exon 11 of 11	NP_001394079.1
	MEN1	NM_001370251.2		c.1834_1854delATCAACTCGAGCGCCATCAAG	p.Ile612_Lys618del	conservative_inframe_deletion	Exon 11 of 11	NP_001357180.2	A0A5F9ZHS3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MEN1	ENST00000450708.7	TSL:5 MANE Select	c.1708_1728delATCAACTCGAGCGCCATCAAG	p.Ile570_Lys576del	conservative_inframe_deletion	Exon 10 of 10	ENSP00000394933.3	O00255-2
	MEN1	ENST00000312049.11	TSL:1	c.1708_1728delATCAACTCGAGCGCCATCAAG	p.Ile570_Lys576del	conservative_inframe_deletion	Exon 10 of 10	ENSP00000308975.6	O00255-2
	MEN1	ENST00000424912.2	TSL:1	c.1708_1728delATCAACTCGAGCGCCATCAAG	p.Ile570_Lys576del	conservative_inframe_deletion	Exon 11 of 11	ENSP00000388016.2	O00255-2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
1	-	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	Multiple endocrine neoplasia, type 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.9
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555163115; hg19: chr11-64571910;