rs1555163115

Variant names:

• chr11-64804438-GCTTGATGGCGCTCGAGTTGAT-G
• rs1555163115
• NM_001370259.2:c.1708_1728delATCAACTCGAGCGCCATCAAG

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_001370259.2(MEN1):​c.1708_1728delATCAACTCGAGCGCCATCAAG​(p.Ile570_Lys576del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MEN1 NM_001370259.2 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 7.88

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001370259.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-64804438-GCTTGATGGCGCTCGAGTTGAT-G is Pathogenic according to our data. Variant chr11-64804438-GCTTGATGGCGCTCGAGTTGAT-G is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 428068.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=1, Uncertain_significance=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MEN1	NM_001370259.2	c.1708_1728delATCAACTCGAGCGCCATCAAG	p.Ile570_Lys576del	conservative_inframe_deletion	Exon 10 of 10	ENST00000450708.7	NP_001357188.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MEN1	ENST00000450708.7	c.1708_1728delATCAACTCGAGCGCCATCAAG	p.Ile570_Lys576del	conservative_inframe_deletion	Exon 10 of 10	5	NM_001370259.2	ENSP00000394933.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Apr 18, 2024

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1708_1728del21 variant (also known as p.I570_K576del) is located in coding exon 9 of the MEN1 gene. This variant results from an in-frame deletion of 21 nucleotides (ATCAACTCGAGCGCCATCAAG) at positions 1708 to 1728. This results in the in-frame deletion of 7 amino acids (INSSAIK) at codons 570 to 576. This variant has been observed in at least one individual with a personal and/or family history that is consistent with multiple endocrine neoplasia type 1 (Ambry internal data). This amino acid region is well conserved in available vertebrate species and the impacted region is critical for protein function (Ambry internal data). In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Multiple endocrine neoplasia, type 1 Uncertain:1

May 07, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.1708_1728del, results in the deletion of 7 amino acid(s) of the MEN1 protein (p.Ile570_Lys576del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MEN1-related conditions. ClinVar contains an entry for this variant (Variation ID: 428068). This variant disrupts a region of the MEN1 protein in which other variant(s) (p.Ile575Asn) have been observed in individuals with MEN1-related conditions (PMID: 16699310). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555163115; hg19: chr11-64571910;