rs1555163115

chr11-64804438-GCTTGATGGCGCTCGAGTTGAT-G

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM4 PP3 PP5_Moderate

The NM_001370259.2(MEN1):c.1708_1728del(p.Ile570_Lys576del) variant causes a inframe deletion change involving the alteration of a conserved nucleotide. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MEN1 NM_001370259.2 inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.88

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001370259.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-64804438-GCTTGATGGCGCTCGAGTTGAT-G is Pathogenic according to our data. Variant chr11-64804438-GCTTGATGGCGCTCGAGTTGAT-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 428068.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
MEN1	NM_001370259.2	c.1708_1728del	p.Ile570_Lys576del	inframe_deletion	10/10	ENST00000450708.7

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
MEN1	ENST00000450708.7	c.1708_1728del	p.Ile570_Lys576del	inframe_deletion	10/10	5	NM_001370259.2	P3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Sep 15, 2015

The c.1708_1728del21 variant (also known as p.I570_K576del) is located in coding exon 9 of the MEN1 gene. This variant results from an in-frame deletion of ATCAACTCGAGCGCCATCAAG between nucleotide positions 1708 and 1728. This results in the deletion of 7 residue between codons 570 and 576 near the C-terminal end of the protein. Based on internal structural analysis, this deletion occurs at the c-terminal end of the MEN1 core domain and is anticipated to result in a significant decrease in structural stability. This variant was not reported in population based cohorts in the following databases: Database of Single Nucleotide Polymorphisms (dbSNP), NHLBI Exome Sequencing Project (ESP), and 1000 Genomes Project. In the ESP, this variant was not observed in 6498 samples (12996 alleles) with coverage at this position. To date, this alteration has been detected with an allele frequency of approximately 0.05% (greater than 1900 alleles tested) in our clinical cohort. This nucleotide region is well conserved in available vertebrate species. Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555163115; hg19: chr11-64571910;