rs1555206402

Variant names:

• chr11-119093273-ATGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCC-A
• rs1555206402
• NM_000190.4:c.1078_*46delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP5_Moderate

The NM_000190.4(HMBS):​c.1078_*46delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT​(p.Ala360ThrfsTer73) variant causes a frameshift, stop lost change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: HMBS NM_000190.4 frameshift, stop_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.12
• Publications: 1 publications found

Genes affected

HMBS (HGNC:4982): (hydroxymethylbilane synthase) This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

HMBS Gene-Disease associations (from GenCC):

• acute intermittent porphyria

  Inheritance: SD, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Stoplost variant in NM_000190.4 Downstream stopcodon found after 53 codons.
• PP5: Variant 11-119093273-ATGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCC-A is Pathogenic according to our data. Variant chr11-119093273-ATGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 549662.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HMBS	NM_000190.4	c.1078_*46delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT	p.Ala360ThrfsTer73	frameshift_variant, stop_lost	Exon 14 of 14	ENST00000652429.1	NP_000181.2
HMBS	NM_000190.4	c.1078_*46delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT		3_prime_UTR_variant	Exon 14 of 14	ENST00000652429.1	NP_000181.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HMBS	ENST00000652429.1	c.1078_*46delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT	p.Ala360ThrfsTer73	frameshift_variant, stop_lost	Exon 14 of 14		NM_000190.4	ENSP00000498786.1
HMBS	ENST00000652429.1	c.1078_*46delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT		3_prime_UTR_variant	Exon 14 of 14		NM_000190.4	ENSP00000498786.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Acute intermittent porphyria Pathogenic:1

May 20, 2017

Endocrinology Department, First Hospital Of Shanxi Medical University

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.1
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555206402; hg19: chr11-118963983;