rs1555281357

Variant names:

• chr13-32329481-GATACTACTGCTGTAAGTAAATATGACATTGATT-G
• rs1555281357
• NM_000059.4:c.672_681+23delTACTACTGCTGTAAGTAAATATGACATTGATTA

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_000059.4(BRCA2):​c.672_681+23delTACTACTGCTGTAAGTAAATATGACATTGATTA​(p.Asp224HisfsTer3184) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRCA2 NM_000059.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 2.08

Genes affected

BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 13-32329481-GATACTACTGCTGTAAGTAAATATGACATTGATT-G is Pathogenic according to our data. Variant chr13-32329481-GATACTACTGCTGTAAGTAAATATGACATTGATT-G is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 462411.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=2, Pathogenic=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BRCA2	NM_000059.4	c.672_681+23delTACTACTGCTGTAAGTAAATATGACATTGATTA	p.Asp224HisfsTer3184	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 8 of 27	ENST00000380152.8	NP_000050.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BRCA2	ENST00000380152.8	c.671_681+22delATACTACTGCTGTAAGTAAATATGACATTGATT	p.Asp224HisfsTer3184	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 8 of 27	5	NM_000059.4	ENSP00000369497.3
BRCA2	ENST00000530893.7	c.302_312+22delATACTACTGCTGTAAGTAAATATGACATTGATT	p.Asp101HisfsTer3184	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 8 of 27	1		ENSP00000499438.2
BRCA2	ENST00000614259.2	n.671_681+22delATACTACTGCTGTAAGTAAATATGACATTGATT		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 7 of 26	2		ENSP00000506251.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary breast ovarian cancer syndrome Pathogenic:1

May 06, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 8 of the BRCA2 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in BRCA2 are known to be pathogenic (PMID: 20104584). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with BRCA2-related conditions. ClinVar contains an entry for this variant (Variation ID: 462411). For these reasons, this variant has been classified as Pathogenic. -

not provided Uncertain:1

Dec 07, 2023

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame transcript, E6Q39_E8, able to complement growth in mouse embryonic stem cells, leading to homology-directed repair activity comparable to wild-type (PMID: 32398771); Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge; This variant is associated with the following publications: (PMID: 32398771) -

Hereditary cancer-predisposing syndrome Uncertain:1

Jun 06, 2022

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.672_681+23DEL33 variant results from a deletion of 33 nucleotides starting at position 672 in coding exon 7 and extending 23 nucleotides into intron 7 of the BRCA2 gene. RNA studies have demonstrated that this alteration results in abnormal splicing in the set of samples tested; however a significant portion of the transcript is in-frame (Ambry internal data). This in-frame transcript, referred to as Δ(E6Q39_E8) in the literature, has been shown to perform complementation in mouse embryonic stem cells and maintains 90% activity in a homology-directed repair functional assay (Mesman, RLS et al. Genet Med 2020 08;22(8):1355-1365). Since supporting evidence is conflicting at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555281357; hg19: chr13-32903618;