rs1555281357

Variant names:

• chr13-32329481-GATACTACTGCTGTAAGTAAATATGACATTGATT-G
• rs1555281357
• NM_000059.4:c.672_681+23delTACTACTGCTGTAAGTAAATATGACATTGATTA

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_000059.4(BRCA2):​c.672_681+23delTACTACTGCTGTAAGTAAATATGACATTGATTA​(p.Asp224HisfsTer3184) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. D224D) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRCA2 NM_000059.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 2.08
• Publications: 1 publications found

Genes affected

BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

BRCA2 Gene-Disease associations (from GenCC):

• breast-ovarian cancer, familial, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
• Fanconi anemia complementation group D1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• pancreatic cancer, susceptibility to, 2

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• sarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• medulloblastoma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 13-32329481-GATACTACTGCTGTAAGTAAATATGACATTGATT-G is Pathogenic according to our data. Variant chr13-32329481-GATACTACTGCTGTAAGTAAATATGACATTGATT-G is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 462411.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000059.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRCA2	NM_000059.4	MANE Select	c.672_681+23delTACTACTGCTGTAAGTAAATATGACATTGATTA	p.Asp224HisfsTer3184	frameshift splice_donor splice_region intron	Exon 8 of 27	NP_000050.3
	BRCA2	NM_001432077.1		c.672_681+23delTACTACTGCTGTAAGTAAATATGACATTGATTA	p.Asp224HisfsTer3184	frameshift splice_donor splice_region intron	Exon 8 of 27	NP_001419006.1
	BRCA2	NM_001406720.1		c.672_681+23delTACTACTGCTGTAAGTAAATATGACATTGATTA	p.Asp224HisfsTer3167	frameshift splice_donor splice_region intron	Exon 8 of 27	NP_001393649.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRCA2	ENST00000380152.8	TSL:5 MANE Select	c.671_681+22delATACTACTGCTGTAAGTAAATATGACATTGATT	p.Asp224HisfsTer3184	frameshift splice_donor splice_region intron	Exon 8 of 27	ENSP00000369497.3
	BRCA2	ENST00000544455.6	TSL:1	c.671_681+22delATACTACTGCTGTAAGTAAATATGACATTGATT	p.Asp224HisfsTer3184	frameshift splice_donor splice_region intron	Exon 8 of 27	ENSP00000439902.1
	BRCA2	ENST00000530893.7	TSL:1	c.302_312+22delATACTACTGCTGTAAGTAAATATGACATTGATT	p.Asp101HisfsTer3184	frameshift splice_donor splice_region intron	Exon 8 of 27	ENSP00000499438.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
1	-	-	Hereditary breast ovarian cancer syndrome (1)
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555281357; hg19: chr13-32903618;