rs1555282448

Variant names:

• chr13-32336453-TTATTTATTACCCCAGAAGC-GCA
• rs1555282448
• NM_000059.4:c.2098_2117delTTATTTATTACCCCAGAAGCinsGCA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000059.4(BRCA2):​c.2098_2117delTTATTTATTACCCCAGAAGCinsGCA​(p.Leu700AlafsTer2) variant causes a frameshift, missense change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L700L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRCA2 NM_000059.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.24
• Publications: 1 publications found

Genes affected

BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

BRCA2 Gene-Disease associations (from GenCC):

• breast-ovarian cancer, familial, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
• Fanconi anemia complementation group D1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• pancreatic cancer, susceptibility to, 2

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• sarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• medulloblastoma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 13-32336453-TTATTTATTACCCCAGAAGC-GCA is Pathogenic according to our data. Variant chr13-32336453-TTATTTATTACCCCAGAAGC-GCA is described in ClinVar as Pathogenic. ClinVar VariationId is 462256.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BRCA2	NM_000059.4	c.2098_2117delTTATTTATTACCCCAGAAGCinsGCA	p.Leu700AlafsTer2	frameshift_variant, missense_variant	Exon 11 of 27	ENST00000380152.8	NP_000050.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BRCA2	ENST00000380152.8	c.2098_2117delTTATTTATTACCCCAGAAGCinsGCA	p.Leu700AlafsTer2	frameshift_variant, missense_variant	Exon 11 of 27	5	NM_000059.4	ENSP00000369497.3
BRCA2	ENST00000530893.7	c.1729_1748delTTATTTATTACCCCAGAAGCinsGCA	p.Leu577AlafsTer2	frameshift_variant, missense_variant	Exon 11 of 27	1		ENSP00000499438.2
BRCA2	ENST00000614259.2	n.2098_2117delTTATTTATTACCCCAGAAGCinsGCA		non_coding_transcript_exon_variant	Exon 10 of 26	2		ENSP00000506251.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary breast ovarian cancer syndrome Pathogenic:1

Jul 19, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Loss-of-function variants in BRCA2 are known to be pathogenic (PMID: 20104584). This variant is not present in population databases (ExAC no frequency). This variant, c.2098_2117delinsGCA, is a complex sequence change that causes a frameshift at codon 700. This creates a premature translational stop signal (p.Leu700Alafs*2) and is expected to result in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with BRCA2-related disease. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555282448; hg19: chr13-32910590;