rs1555283841

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000059.4(BRCA2):​c.4551_4593delAGAACCTACTCTATTGGGTTTTCATACAGCTAGCGGGAAAAAA​(p.Glu1518fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

BRCA2
NM_000059.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 1.90
Variant links:
Genes affected
BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 13-32338903-CAAAGAACCTACTCTATTGGGTTTTCATACAGCTAGCGGGAAAA-C is Pathogenic according to our data. Variant chr13-32338903-CAAAGAACCTACTCTATTGGGTTTTCATACAGCTAGCGGGAAAA-C is described in ClinVar as [Pathogenic]. Clinvar id is 531201.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
BRCA2NM_000059.4 linkuse as main transcriptc.4551_4593delAGAACCTACTCTATTGGGTTTTCATACAGCTAGCGGGAAAAAA p.Glu1518fs frameshift_variant 11/27 ENST00000380152.8 NP_000050.3 P51587

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
BRCA2ENST00000380152.8 linkuse as main transcriptc.4551_4593delAGAACCTACTCTATTGGGTTTTCATACAGCTAGCGGGAAAAAA p.Glu1518fs frameshift_variant 11/275 NM_000059.4 ENSP00000369497.3 P51587
BRCA2ENST00000530893.7 linkuse as main transcriptc.4182_4224delAGAACCTACTCTATTGGGTTTTCATACAGCTAGCGGGAAAAAA p.Glu1395fs frameshift_variant 11/271 ENSP00000499438.2 A0A590UJI7
BRCA2ENST00000614259.2 linkuse as main transcriptn.4551_4593delAGAACCTACTCTATTGGGTTTTCATACAGCTAGCGGGAAAAAA non_coding_transcript_exon_variant 10/262 ENSP00000506251.1 A0A7P0TAP7

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary breast ovarian cancer syndrome Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpSep 07, 2019For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in BRCA2 are known to be pathogenic (PMID: 20104584). This variant has not been reported in the literature in individuals with BRCA2-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Glu1518Leufs*11) in the BRCA2 gene. It is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555283841; hg19: chr13-32913040; API