rs1555288431
- chr13-32379740-CTCCAAACAGTTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCGGTACAAACCTTTCATTGTAATTTTTCAGTTTTGATAAGTGCTTGTTAGTTTATGGAATCTCCATATGTTGAATTTTTGTTTTGTTTTCTGTAGGTTTCAGATGAAATTTTA-C
- rs1555288431
- NM_000059.4:c.8954-8_9136del
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP5_Moderate
The NM_000059.4(BRCA2):c.8954-8_9136del(p.Ile2986_Phe3046del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. I2986I) has been classified as Likely benign.
Frequency
Consequence
NM_000059.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- breast-ovarian cancer, familial, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
- Fanconi anemia complementation group D1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- pancreatic cancer, susceptibility to, 2Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- medulloblastomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| BRCA2 | NM_000059.4 | c.8954-8_9136del | p.Ile2986_Phe3046del | conservative_inframe_deletion | Exon 24 of 27 | ENST00000380152.8 | NP_000050.3 | |
| BRCA2 | NM_000059.4 | c.8954-8_9136del | exon_loss_variant | Exon 23 of 27 | ENST00000380152.8 | NP_000050.3 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| BRCA2 | ENST00000614259.2 | n.*1012-9_*1193del | conservative_inframe_deletion | Exon 22 of 26 | 2 | ENSP00000506251.1 | ||||
| BRCA2 | ENST00000380152.8 | c.8954-9_9135del | exon_loss_variant | Exon 23 of 27 | 5 | NM_000059.4 | ENSP00000369497.3 | |||
| BRCA2 | ENST00000530893.7 | c.8585-9_8766del | exon_loss_variant | Exon 23 of 27 | 1 | ENSP00000499438.2 | ||||
| BRCA2 | ENST00000614259.2 | n.*1012-9_*1193del | exon_loss_variant | Exon 22 of 26 | 2 | ENSP00000506251.1 | ||||
| BRCA2 | ENST00000380152.8 | c.8954-9_9135del | p.Ile2986fs | frameshift_variant | Exon 23 of 27 | 5 | NM_000059.4 | ENSP00000369497.3 | ||
| BRCA2 | ENST00000530893.7 | c.8585-9_8766del | p.Ile2863fs | frameshift_variant | Exon 23 of 27 | 1 | ENSP00000499438.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Breast-ovarian cancer, familial, susceptibility to, 2 Pathogenic:1
- -
Hereditary breast ovarian cancer syndrome Pathogenic:1
This variant is a gross deletion of the genomic region encompassing exon 23 and the first 19 nucleotides of exon 24 of the BRCA2 gene (c.8954-8_9136del). The 5' breakpoint of this deletion is within intron 22 at c.8954-8, and the 3' breakpoint is within exon 24 at c.9136. This creates a premature translational stop signal and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in BRCA2 are known to be pathogenic (PMID: 20104584). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at