rs1555507411

Positions:

• chr16-10915569-GGCTGGGCCCTGTCTCAGGCCCCCAGGCTTTCCCCAAACTGGTGCGGATCCTCACGGCCTTTTCCTCCCTGCAGCATCTGGA-G

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_000246.4(CIITA):​c.2890_2969+1delCTGGGCCCTGTCTCAGGCCCCCAGGCTTTCCCCAAACTGGTGCGGATCCTCACGGCCTTTTCCTCCCTGCAGCATCTGGAG​(p.Leu964fs) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. L964L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CIITA NM_000246.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 6.23

Genes affected

CIITA (HGNC:7067): (class II major histocompatibility complex transactivator) This gene encodes a protein with an acidic transcriptional activation domain, 4 LRRs (leucine-rich repeats) and a GTP binding domain. The protein is located in the nucleus and acts as a positive regulator of class II major histocompatibility complex gene transcription, and is referred to as the "master control factor" for the expression of these genes. The protein also binds GTP and uses GTP binding to facilitate its own transport into the nucleus. Once in the nucleus it does not bind DNA but rather uses an intrinsic acetyltransferase (AT) activity to act in a coactivator-like fashion. Mutations in this gene have been associated with bare lymphocyte syndrome type II (also known as hereditary MHC class II deficiency or HLA class II-deficient combined immunodeficiency), increased susceptibility to rheumatoid arthritis, multiple sclerosis, and possibly myocardial infarction. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]

CIITA (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-10915569-GGCTGGGCCCTGTCTCAGGCCCCCAGGCTTTCCCCAAACTGGTGCGGATCCTCACGGCCTTTTCCTCCCTGCAGCATCTGGA-G is Pathogenic according to our data. Variant chr16-10915569-GGCTGGGCCCTGTCTCAGGCCCCCAGGCTTTCCCCAAACTGGTGCGGATCCTCACGGCCTTTTCCTCCCTGCAGCATCTGGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 9544.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CIITA	NM_000246.4	c.2890_2969+1delCTGGGCCCTGTCTCAGGCCCCCAGGCTTTCCCCAAACTGGTGCGGATCCTCACGGCCTTTTCCTCCCTGCAGCATCTGGAG	p.Leu964fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	14/20	ENST00000324288.14	NP_000237.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CIITA	ENST00000324288.14	c.2890_2969+1delCTGGGCCCTGTCTCAGGCCCCCAGGCTTTCCCCAAACTGGTGCGGATCCTCACGGCCTTTTCCTCCCTGCAGCATCTGGAG	p.Leu964fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	14/20	1	NM_000246.4	ENSP00000316328.8

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

MHC class II deficiency 1 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Feb 01, 2002

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555507411; hg19: chr16-11009426;