rs1555517889

Variant names:

• chr16-68829742-CCCGGTATCTTCCCCGCCCTG-C
• rs1555517889
• NM_004360.5:c.2387_2406delGGTATCTTCCCCGCCCTGCC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM5_Supporting PM2_Supporting PVS1_Strong

This summary comes from the ClinGen Evidence Repository: The NM_004360.5:c.2387_2406del (p.Arg796GlnfsTer4) variant in CDH1 is a frameshift variant that may cause a premature stop codon that is predicted to escape nonsense mediated decay. However, this truncated region is critical to protein function and located upstream the most 3' well-characterized pathogenic variant c.2506G>T (pGlu836Ter) (PVS1_Strong, PM5_Supporting; PMID:29798843, ClinVar Variation ID: 479504). This variant is absent in gnomAD 2.1.1 (PM2_Supporting). In summary, this variant meets the criteria to be classified as likely pathogenic for DGLBCS based on the ACMG/AMP criteria applied, as specified by the ClinGen CDH1 VCEP: PVS1_Strong, PM5_Supporting, PM2_Supporting. (CDH1 VCEP specifications version 3.1) LINK:https://erepo.genome.network/evrepo/ui/classification/CA658798634/MONDO:0100488/007

• Frequency: Genomes: not found (cov: 32)
• Consequence: CDH1 NM_004360.5 frameshift
• Clinical Significance: Likely pathogenic reviewed by expert panel P:2
• Conservation: PhyloP100: 7.91

Genes affected

CDH1 (HGNC:1748): (cadherin 1) This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Mutations in this gene are correlated with gastric, breast, colorectal, thyroid and ovarian cancer. Loss of function of this gene is thought to contribute to cancer progression by increasing proliferation, invasion, and/or metastasis. The ectodomain of this protein mediates bacterial adhesion to mammalian cells and the cytoplasmic domain is required for internalization. This gene is present in a gene cluster with other members of the cadherin family on chromosome 16. [provided by RefSeq, Nov 2015]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.
• PM5: For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CDH1	NM_004360.5	c.2387_2406delGGTATCTTCCCCGCCCTGCC	p.Arg796GlnfsTer4	frameshift_variant	Exon 15 of 16	ENST00000261769.10	NP_004351.1
CDH1	NM_001317184.2	c.2204_2223delGGTATCTTCCCCGCCCTGCC	p.Arg735GlnfsTer4	frameshift_variant	Exon 14 of 15		NP_001304113.1
CDH1	NM_001317185.2	c.839_858delGGTATCTTCCCCGCCCTGCC	p.Arg280GlnfsTer4	frameshift_variant	Exon 15 of 16		NP_001304114.1
CDH1	NM_001317186.2	c.422_441delGGTATCTTCCCCGCCCTGCC	p.Arg141GlnfsTer4	frameshift_variant	Exon 14 of 15		NP_001304115.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CDH1	ENST00000261769.10	c.2387_2406delGGTATCTTCCCCGCCCTGCC	p.Arg796GlnfsTer4	frameshift_variant	Exon 15 of 16	1	NM_004360.5	ENSP00000261769.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: reviewed by expert panel

Submissions by phenotype

Hereditary diffuse gastric adenocarcinoma Pathogenic:1

Nov 27, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change results in a premature translational stop signal in the CDH1 gene (p.Arg796Glnfs*4). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 87 amino acids of the CDH1 protein. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with CDH1-related disease. This variant is expected to disrupt the C-terminal portion of the cytoplasmic domain of the CDH1 (E-cadherin) protein, which includes the PIP5K1C (phosphatidylinositol phosphate kinase, type I gamma) binding domain (residues Leu830-Ser847) and the CTNNB1 (beta-catenin) binding domain (residues Val832-Tyr861) (PMID: 22850631). Although functional studies have not been performed for this particular variant, loss of these domains is expected to disrupt normal CDH1 function. This suggests that disruption of this region of the CDH1 protein is causative of disease. For these reasons, this variant has been classified as Pathogenic. -

CDH1-related diffuse gastric and lobular breast cancer syndrome Pathogenic:1

Aug 02, 2023

ClinGen CDH1 Variant Curation Expert Panel

Significance: Likely pathogenic

Review Status: reviewed by expert panel

Collection Method: curation

The NM_004360.5:c.2387_2406del (p.Arg796GlnfsTer4) variant in CDH1 is a frameshift variant that may cause a premature stop codon that is predicted to escape nonsense mediated decay. However, this truncated region is critical to protein function and located upstream the most 3' well-characterized pathogenic variant c.2506G>T (pGlu836Ter) (PVS1_Strong, PM5_Supporting; PMID: 29798843, ClinVar Variation ID: 479504). This variant is absent in gnomAD 2.1.1 (PM2_Supporting). In summary, this variant meets the criteria to be classified as likely pathogenic for DGLBCS based on the ACMG/AMP criteria applied, as specified by the ClinGen CDH1 VCEP: PVS1_Strong, PM5_Supporting, PM2_Supporting. (CDH1 VCEP specifications version 3.1) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555517889; hg19: chr16-68863645;