rs1555517889
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM5_SupportingPM2_SupportingPVS1_Strong
This summary comes from the ClinGen Evidence Repository: The NM_004360.5:c.2387_2406del (p.Arg796GlnfsTer4) variant in CDH1 is a frameshift variant that may cause a premature stop codon that is predicted to escape nonsense mediated decay. However, this truncated region is critical to protein function and located upstream the most 3' well-characterized pathogenic variant c.2506G>T (pGlu836Ter) (PVS1_Strong, PM5_Supporting; PMID:29798843, ClinVar Variation ID: 479504). This variant is absent in gnomAD 2.1.1 (PM2_Supporting). In summary, this variant meets the criteria to be classified as likely pathogenic for DGLBCS based on the ACMG/AMP criteria applied, as specified by the ClinGen CDH1 VCEP: PVS1_Strong, PM5_Supporting, PM2_Supporting. (CDH1 VCEP specifications version 3.1) LINK:https://erepo.genome.network/evrepo/ui/classification/CA658798634/MONDO:0100488/007
Frequency
Consequence
NM_004360.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- blepharocheilodontic syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Illumina, G2P, Labcorp Genetics (formerly Invitae)
- CDH1-related diffuse gastric and lobular breast cancer syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen
- hereditary breast carcinomaInheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
- hereditary diffuse gastric adenocarcinomaInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
- cleft soft palateInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- orofacial cleft 3Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- blepharocheilodontic syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial ovarian cancerInheritance: Unknown Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004360.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDH1 | MANE Select | c.2387_2406delGGTATCTTCCCCGCCCTGCC | p.Arg796GlnfsTer4 | frameshift | Exon 15 of 16 | NP_004351.1 | A0A0U2ZQU7 | ||
| CDH1 | c.2204_2223delGGTATCTTCCCCGCCCTGCC | p.Arg735GlnfsTer4 | frameshift | Exon 14 of 15 | NP_001304113.1 | P12830-2 | |||
| CDH1 | c.839_858delGGTATCTTCCCCGCCCTGCC | p.Arg280GlnfsTer4 | frameshift | Exon 15 of 16 | NP_001304114.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDH1 | TSL:1 MANE Select | c.2387_2406delGGTATCTTCCCCGCCCTGCC | p.Arg796GlnfsTer4 | frameshift | Exon 15 of 16 | ENSP00000261769.4 | P12830-1 | ||
| CDH1 | TSL:1 | c.2204_2223delGGTATCTTCCCCGCCCTGCC | p.Arg735GlnfsTer4 | frameshift | Exon 14 of 15 | ENSP00000414946.2 | P12830-2 | ||
| CDH1 | TSL:1 | n.2458_2477delGGTATCTTCCCCGCCCTGCC | non_coding_transcript_exon | Exon 14 of 15 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.