rs1555533543

Variant names:

• chr17-31327454-GAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA-G
• rs1555533543
• NM_001042492.3:c.5269-41_5291delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001042492.3(NF1):​c.5269-41_5291delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT​(p.Val1757fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: NF1 NM_001042492.3 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.66

Genes affected

NF1 (HGNC:7765): (neurofibromin 1) This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-31327454-GAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA-G is Pathogenic according to our data. Variant chr17-31327454-GAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA-G is described in ClinVar as [Pathogenic]. Clinvar id is 457747.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NF1	NM_001042492.3	c.5269-41_5291delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT	p.Val1757fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 38 of 58	ENST00000358273.9	NP_001035957.1
NF1	NM_000267.3	c.5206-41_5228delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT	p.Val1736fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 37 of 57		NP_000258.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NF1	ENST00000358273.9	c.5269-44_5288delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA	p.Val1757fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 38 of 58	1	NM_001042492.3	ENSP00000351015.4

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Neurofibromatosis, type 1 Pathogenic:1

Jun 22, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects an acceptor splice site in intron 36 and removes the first 23 nucleotides of exon 37 of the NF1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in NF1 are known to be pathogenic (PMID: 10712197, 23913538). For these reasons, this variant has been classified as Pathogenic. A single nucleotide change affecting the acceptor splice site, c.5206-1G>A, has been classified as pathogenic (Invitae). In addition, a smaller deletion c.5206-5_5220del has been reported in an individual suspected with NF1 (PMID: 23758643). This suggests that the deleted region is important for normal RNA splicing, and that other variants at this position may also be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555533543; hg19: chr17-29654472;