rs1555533543

Variant names:

• chr17-31327454-GAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA-G
• rs1555533543
• ENST00000579081.6:n.*434-44_*453delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate

The ENST00000579081.6(NF1):​n.*434-44_*453delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: NF1 ENST00000579081.6 splice_region, non_coding_transcript_exon
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.66
• Publications: 0 publications found

Genes affected

NF1 (HGNC:7765): (neurofibromin 1) This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]

NF1 Gene-Disease associations (from GenCC):

• neurofibromatosis type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, PanelApp Australia, G2P, Genomics England PanelApp
• neurofibromatosis-Noonan syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, PanelApp Australia
• Moyamoya disease

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial ovarian cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PP5: Variant 17-31327454-GAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA-G is Pathogenic according to our data. Variant chr17-31327454-GAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 457747.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000579081.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NF1	NM_001042492.3	MANE Select	c.5269-41_5291delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT	p.Val1757fs	frameshift splice_acceptor splice_region intron	Exon 38 of 58	NP_001035957.1
	NF1	NM_000267.4		c.5206-41_5228delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT	p.Val1736fs	frameshift splice_acceptor splice_region intron	Exon 37 of 57	NP_000258.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NF1	ENST00000579081.6	TSL:1	n.*434-44_*453delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA		splice_region non_coding_transcript_exon	Exon 38 of 58	ENSP00000462408.2
	NF1	ENST00000358273.9	TSL:1 MANE Select	c.5269-44_5288delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA	p.Val1757fs	frameshift splice_acceptor splice_region intron	Exon 38 of 58	ENSP00000351015.4
	NF1	ENST00000356175.7	TSL:1	c.5206-44_5225delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA	p.Val1736fs	frameshift splice_acceptor splice_region intron	Exon 37 of 57	ENSP00000348498.3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Neurofibromatosis, type 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555533543; hg19: chr17-29654472;