rs1555533543

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate

The ENST00000579081.6(NF1):​n.*434-44_*453delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 31)

Consequence

NF1
ENST00000579081.6 splice_region, non_coding_transcript_exon

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 1.66

Publications

0 publications found
Variant links:
Genes affected
NF1 (HGNC:7765): (neurofibromin 1) This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
NF1 Gene-Disease associations (from GenCC):
  • neurofibromatosis type 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, PanelApp Australia, G2P, Genomics England PanelApp
  • neurofibromatosis-Noonan syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, PanelApp Australia
  • Moyamoya disease
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary pheochromocytoma-paraganglioma
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • familial ovarian cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PP5
Variant 17-31327454-GAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA-G is Pathogenic according to our data. Variant chr17-31327454-GAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA-G is described in ClinVar as [Pathogenic]. Clinvar id is 457747.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
NF1NM_001042492.3 linkc.5269-41_5291delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT p.Val1757fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 38 of 58 ENST00000358273.9 NP_001035957.1 P21359-1
NF1NM_000267.4 linkc.5206-41_5228delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT p.Val1736fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 37 of 57 NP_000258.1 P21359-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
NF1ENST00000358273.9 linkc.5269-44_5288delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA p.Val1757fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 38 of 58 1 NM_001042492.3 ENSP00000351015.4 P21359-1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Neurofibromatosis, type 1 Pathogenic:1
Jun 22, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change affects an acceptor splice site in intron 36 and removes the first 23 nucleotides of exon 37 of the NF1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in NF1 are known to be pathogenic (PMID: 10712197, 23913538). For these reasons, this variant has been classified as Pathogenic. A single nucleotide change affecting the acceptor splice site, c.5206-1G>A, has been classified as pathogenic (Invitae). In addition, a smaller deletion c.5206-5_5220del has been reported in an individual suspected with NF1 (PMID: 23758643). This suggests that the deleted region is important for normal RNA splicing, and that other variants at this position may also be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
1.7
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555533543; hg19: chr17-29654472; API