rs1555546066

Variant names:

• chr17-18151166-A-ACCCGTGCTCCTGCGTGCCACT
• rs1555546066
• NM_016239.4:c.7533_7553dupCGTGCTCCTGCGTGCCACTCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_016239.4(MYO15A):​c.7533_7553dupCGTGCTCCTGCGTGCCACTCC​(p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYO15A NM_016239.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.23
• Publications: 0 publications found

Genes affected

MYO15A (HGNC:7594): (myosin XVA) This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]

MYO15A Gene-Disease associations (from GenCC):

• autosomal recessive nonsyndromic hearing loss 3

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), PanelApp Australia
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

LOC124903944 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_016239.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_016239.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYO15A	NM_016239.4	MANE Select	c.7533_7553dupCGTGCTCCTGCGTGCCACTCC	p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro	disruptive_inframe_insertion	Exon 39 of 66	NP_057323.3

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYO15A	ENST00000647165.2	MANE Select	c.7533_7553dupCGTGCTCCTGCGTGCCACTCC	p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro	disruptive_inframe_insertion	Exon 39 of 66	ENSP00000495481.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555546066; hg19: chr17-18054480;