rs1555546066

Variant names:

• chr17-18151166-A-ACCCGTGCTCCTGCGTGCCACT
• rs1555546066
• NM_016239.4:c.7533_7553dupCGTGCTCCTGCGTGCCACTCC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_016239.4(MYO15A):​c.7533_7553dupCGTGCTCCTGCGTGCCACTCC​(p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYO15A NM_016239.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.23

Genes affected

MYO15A (HGNC:7594): (myosin XVA) This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]

LOC124903944 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_016239.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYO15A	NM_016239.4	c.7533_7553dupCGTGCTCCTGCGTGCCACTCC	p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro	disruptive_inframe_insertion	Exon 39 of 66	ENST00000647165.2	NP_057323.3
MYO15A	XM_017024715.3	c.7536_7556dupCGTGCTCCTGCGTGCCACTCC	p.Pro2519_Lys2520insValLeuLeuArgAlaThrPro	disruptive_inframe_insertion	Exon 37 of 64		XP_016880204.1
MYO15A	XM_017024714.3	c.7473_7493dupCGTGCTCCTGCGTGCCACTCC	p.Pro2498_Lys2499insValLeuLeuArgAlaThrPro	disruptive_inframe_insertion	Exon 36 of 63		XP_016880203.1
LOC124903944	XR_007065652.1	n.377+416_377+436dupAGTGGCACGCAGGAGCACGGG		intron_variant	Intron 2 of 2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYO15A	ENST00000647165.2	c.7533_7553dupCGTGCTCCTGCGTGCCACTCC	p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro	disruptive_inframe_insertion	Exon 39 of 66		NM_016239.4	ENSP00000495481.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Apr 25, 2017

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Val2512_Pro2518dup variant in MYO15A has not been previously reported in i ndividuals with hearing loss or in large population studies, though the ability of these studies to accurately detect indels may be limited. This variant is a duplication of 7 amino acids at position 2512 and is not predicted to alter the protein reading-frame. It is unclear if this duplication will impact the prote in, though the amino acid sequence in this region of the protein is not highly c onserved through species. In summary, the clinical significance of this variant is uncertain. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555546066; hg19: chr17-18054480;