rs1555546066
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_016239.4(MYO15A):c.7533_7553dupCGTGCTCCTGCGTGCCACTCC(p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_016239.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive nonsyndromic hearing loss 3Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), PanelApp Australia
- nonsyndromic genetic hearing lossInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_016239.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYO15A | NM_016239.4 | MANE Select | c.7533_7553dupCGTGCTCCTGCGTGCCACTCC | p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro | disruptive_inframe_insertion | Exon 39 of 66 | NP_057323.3 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYO15A | ENST00000647165.2 | MANE Select | c.7533_7553dupCGTGCTCCTGCGTGCCACTCC | p.Pro2518_Lys2519insValLeuLeuArgAlaThrPro | disruptive_inframe_insertion | Exon 39 of 66 | ENSP00000495481.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 34
GnomAD4 genome Cov.: 32
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at