rs1555554098

Variant names:

• chr16-15726912-TGCAGCTCCTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCC-T
• rs1555554098
• NM_002474.3:c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_002474.3(MYH11):​c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC​(p.Arg1241_Leu1264del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MYH11 NM_002474.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.32
• Publications: 0 publications found

Genes affected

MYH11 (HGNC:7569): (myosin heavy chain 11) The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. A chromosomal rearrangement involving this gene is associated with acute myeloid leukemia of the M4Eo subtype. Mutations in this gene are associated with visceral myopathy, megacystis-microcolon-intestinal hypoperistalsis syndrome 2, and familial thoracic aortic aneurysm 4. [provided by RefSeq, May 2022]

ENSG00000263335 (HGNC:):

NDE1 (HGNC:17619): (nudE neurodevelopment protein 1) This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]

NDE1 Gene-Disease associations (from GenCC):

• lissencephaly 4

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• hydranencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• microlissencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• NDE1-related microhydranencephaly

  Inheritance: Unknown, AR Classification: SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_002474.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 16-15726912-TGCAGCTCCTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCC-T is Pathogenic according to our data. Variant chr16-15726912-TGCAGCTCCTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 14132.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYH11	NM_002474.3	c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC	p.Arg1241_Leu1264del	disruptive_inframe_deletion	Exon 28 of 41	ENST00000300036.6	NP_002465.1
MYH11	NM_001040113.2	c.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC	p.Arg1248_Leu1271del	disruptive_inframe_deletion	Exon 29 of 43	ENST00000452625.7	NP_001035202.1
MYH11	NM_001040114.2	c.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC	p.Arg1248_Leu1271del	disruptive_inframe_deletion	Exon 29 of 42		NP_001035203.1
MYH11	NM_022844.3	c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC	p.Arg1241_Leu1264del	disruptive_inframe_deletion	Exon 28 of 42		NP_074035.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYH11	ENST00000300036.6	c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC	p.Arg1241_Leu1264del	disruptive_inframe_deletion	Exon 28 of 41	1	NM_002474.3	ENSP00000300036.5
MYH11	ENST00000452625.7	c.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC	p.Arg1248_Leu1271del	disruptive_inframe_deletion	Exon 29 of 43	1	NM_001040113.2	ENSP00000407821.2

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Aortic aneurysm, familial thoracic 4 Pathogenic:1

Mar 01, 2006

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555554098; hg19: chr16-15820769;