rs1555554098

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2PM4PP3PP5

The NM_002474.3(MYH11):​c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC​(p.Arg1241_Leu1264del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 31)

Consequence

MYH11
NM_002474.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 9.32
Variant links:
Genes affected
MYH11 (HGNC:7569): (myosin heavy chain 11) The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. A chromosomal rearrangement involving this gene is associated with acute myeloid leukemia of the M4Eo subtype. Mutations in this gene are associated with visceral myopathy, megacystis-microcolon-intestinal hypoperistalsis syndrome 2, and familial thoracic aortic aneurysm 4. [provided by RefSeq, May 2022]
NDE1 (HGNC:17619): (nudE neurodevelopment protein 1) This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_002474.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 16-15726912-TGCAGCTCCTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCC-T is Pathogenic according to our data. Variant chr16-15726912-TGCAGCTCCTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCC-T is described in ClinVar as [Pathogenic]. Clinvar id is 14132.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MYH11NM_002474.3 linkuse as main transcriptc.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC p.Arg1241_Leu1264del disruptive_inframe_deletion 28/41 ENST00000300036.6 NP_002465.1 P35749-1A0A024QZJ4
MYH11NM_001040113.2 linkuse as main transcriptc.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC p.Arg1248_Leu1271del disruptive_inframe_deletion 29/43 ENST00000452625.7 NP_001035202.1 P35749-3
MYH11NM_001040114.2 linkuse as main transcriptc.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC p.Arg1248_Leu1271del disruptive_inframe_deletion 29/42 NP_001035203.1 P35749-2
MYH11NM_022844.3 linkuse as main transcriptc.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC p.Arg1241_Leu1264del disruptive_inframe_deletion 28/42 NP_074035.1 P35749-4A0A024QZJ6

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MYH11ENST00000300036.6 linkuse as main transcriptc.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC p.Arg1241_Leu1264del disruptive_inframe_deletion 28/411 NM_002474.3 ENSP00000300036.5 P35749-1
MYH11ENST00000452625.7 linkuse as main transcriptc.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC p.Arg1248_Leu1271del disruptive_inframe_deletion 29/431 NM_001040113.2 ENSP00000407821.2 P35749-3

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Aortic aneurysm, familial thoracic 4 Pathogenic:1
Pathogenic, no assertion criteria providedliterature onlyOMIMMar 01, 2006- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555554098; hg19: chr16-15820769; API