rs1555571246

chr17-12992883-C-CATCCTCCAGGCCGCCTGCCAGCTCCCTGGACAGGAGGGCCGCCCGCACCTGCCGCAGCTCCCG

Variant summary

Our verdict is Likely benign. Variant got -3 ACMG points: 2P and 5B. PM4 BP6 BS1

The NM_018127.7(ELAC2):c.2415_2416insCGGGAGCTGCGGCAGGTGCGGGCGGCCCTCCTGTCCAGGGAGCTGGCAGGCGGCCTGGAGGAT(p.Arg785_Asp805dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00162 in 1,456,472 control chromosomes in the GnomAD database, including 27 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0017 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0016 (27 hom.)
  • Failed GnomAD Quality Control
• Consequence: ELAC2 NM_018127.7 inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:1
• Conservation: PhyloP100: -0.695

Genes affected

ELAC2 (HGNC:14198): (elaC ribonuclease Z 2) The protein encoded by this gene has a C-terminal domain with tRNA 3′ processing endoribonuclease activity, which catalyzes the removal of the 3' trailer from precursor tRNAs. The protein also interacts with activated Smad family member 2 (Smad2) and its nuclear partner forkhead box H1 (also known as FAST-1), and reduced expression can suppress transforming growth factor-beta induced growth arrest. Mutations in this gene result in an increased risk of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

ACMG classification

Verdict is Likely_benign. Variant got -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_018127.7.
• BP6: Variant 17-12992883-C-CATCCTCCAGGCCGCCTGCCAGCTCCCTGGACAGGAGGGCCGCCCGCACCTGCCGCAGCTCCCG is Benign according to our data. Variant chr17-12992883-C-CATCCTCCAGGCCGCCTGCCAGCTCCCTGGACAGGAGGGCCGCCCGCACCTGCCGCAGCTCCCG is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 408865.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=2, Likely_benign=1}.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4_exome allele frequency = 0.00162 (2353/1456472) while in subpopulation NFE AF= 0.00181 (2003/1108126). AF 95% confidence interval is 0.00174. There are 27 homozygotes in gnomad4_exome. There are 1184 alleles in male gnomad4_exome subpopulation. Median coverage is 32. This position pass quality control queck.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
ELAC2	NM_018127.7	c.2415_2416insCGGGAGCTGCGGCAGGTGCGGGCGGCCCTCCTGTCCAGGGAGCTGGCAGGCGGCCTGGAGGAT	p.Arg785_Asp805dup	inframe_insertion	24/24	ENST00000338034.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
ELAC2	ENST00000338034.9	c.2415_2416insCGGGAGCTGCGGCAGGTGCGGGCGGCCCTCCTGTCCAGGGAGCTGGCAGGCGGCCTGGAGGAT	p.Arg785_Asp805dup	inframe_insertion	24/24	1	NM_018127.7	P2

Frequencies

GnomAD3 genomes AF: 0.00 AC: 259 AN: 152060 Hom.: 0 Cov.: 33 FAILED QC

Gnomad AFR AF: 0.000314

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000785

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00350

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00281

Gnomad OTH AF: 0.00287

GnomAD3 exomes AF: 0.000744 AC: 186 AN: 249920 Hom.: 1 AF XY: 0.000813 AC XY: 110 AN XY: 135222

Gnomad AFR exome AF: 0.000185

Gnomad AMR exome AF: 0.000463

Gnomad ASJ exome AF: 0.000496

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.0000653

Gnomad FIN exome AF: 0.00141

Gnomad NFE exome AF: 0.00109

Gnomad OTH exome AF: 0.00131

GnomAD4 exome AF: 0.00162 AC: 2353 AN: 1456472 Hom.: 27 Cov.: 32 AF XY: 0.00163 AC XY: 1184 AN XY: 724764

Gnomad4 AFR exome AF: 0.000329

Gnomad4 AMR exome AF: 0.000671

Gnomad4 ASJ exome AF: 0.000459

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000232

Gnomad4 FIN exome AF: 0.00334

Gnomad4 NFE exome AF: 0.00181

Gnomad4 OTH exome AF: 0.00201

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00170 AC: 259 AN: 152178 Hom.: 0 Cov.: 33 AF XY: 0.00177 AC XY: 132 AN XY: 74388

Gnomad4 AFR AF: 0.000313

Gnomad4 AMR AF: 0.000784

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00350

Gnomad4 NFE AF: 0.00281

Gnomad4 OTH AF: 0.00284

Alfa AF: 0.00211 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Inborn genetic diseases Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Jan 28, 2022

The c.2353_2415dupCGGGAGCTGCGGCAGGTGCGGGCGGCCCTCCTGTCCAGGGAGCTGGCAGGCGGCCTGGAGGAT (p.R785_D805dup) gross duplication spans coding exons XXXX through XXXX in the ELAC2 gene; however, the exact breakpoints of the deletion were not determined. Gene duplications are expected to disrupt gene function; however, it is unclear whether this duplication is disruptive to the ELAC2 gene, or is merely duplicated adjacent to the original xxxx gene or located elsewhere in the genome (Mazzarella, R and Schlessinger, D Genome Res 1998;8:1007-1021). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Combined oxidative phosphorylation defect type 17 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Oct 20, 2022

This variant, c.2353_2415dup, results in the insertion of 21 amino acid(s) of the ELAC2 protein (p.Arg785_Asp805dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.2%), including at least one homozygous and/or hemizygous individual. This variant has not been reported in the literature in individuals affected with ELAC2-related conditions. ClinVar contains an entry for this variant (Variation ID: 408865). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

ELAC2-related disorder Benign:1

Likely benign, criteria provided, single submitter

clinical testing

PreventionGenetics, part of Exact Sciences

Jun 17, 2022

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555571246; hg19: chr17-12896200;