rs1555573633
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP3PP5
The NM_005557.4(KRT16):c.1244_1270delCCACCTACCGCCGCCTGCTGGAGGGCGinsGGC(p.Ala415_Glu424delinsGlyGln) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_005557.4 missense, disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- pachyonychia congenita 1Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
- palmoplantar keratoderma, nonepidermolytic, focal 1Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Genomics England PanelApp
- isolated focal non-epidermolytic palmoplantar keratodermaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- pachyonychia congenitaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005557.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KRT16 | TSL:1 MANE Select | c.1244_1270delCCACCTACCGCCGCCTGCTGGAGGGCGinsGGC | p.Ala415_Glu424delinsGlyGln | missense disruptive_inframe_deletion | N/A | ENSP00000301653.3 | P08779 | ||
| KRT16 | TSL:3 | c.*42_*68delCCACCTACCGCCGCCTGCTGGAGGGCGinsGGC | downstream_gene | N/A | ENSP00000467124.1 | K7ENW6 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.