rs1555580263

Variant names:

• chr17-63837200-G-GAGGTAGAACCTTATCTGCCATCTTC
• rs1555580263
• NM_001098426.2:c.414_438dupGAAGATGGCAGATAAGGTTCTACCT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001098426.2(SMARCD2):​c.414_438dupGAAGATGGCAGATAAGGTTCTACCT​(p.Gln147GlufsTer5) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SMARCD2 NM_001098426.2 frameshift, stop_gained
• Clinical Significance: Pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: 0.570
• Publications: 0 publications found

Genes affected

SMARCD2 (HGNC:11107): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2) The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

SMARCD2 Gene-Disease associations (from GenCC):

• specific granule deficiency 2

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• specific granule deficiency

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-63837200-G-GAGGTAGAACCTTATCTGCCATCTTC is Pathogenic according to our data. Variant chr17-63837200-G-GAGGTAGAACCTTATCTGCCATCTTC is described in ClinVar as [Pathogenic]. Clinvar id is 369730.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SMARCD2	NM_001098426.2	c.414_438dupGAAGATGGCAGATAAGGTTCTACCT	p.Gln147GlufsTer5	frameshift_variant, stop_gained	Exon 3 of 13	ENST00000448276.7	NP_001091896.1
SMARCD2	NM_001330440.2	c.270_294dupGAAGATGGCAGATAAGGTTCTACCT	p.Gln99GlufsTer5	frameshift_variant, stop_gained	Exon 3 of 13		NP_001317369.1
SMARCD2	NM_001330439.1	c.189_213dupGAAGATGGCAGATAAGGTTCTACCT	p.Gln72GlufsTer5	frameshift_variant, stop_gained	Exon 3 of 13		NP_001317368.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SMARCD2	ENST00000448276.7	c.414_438dupGAAGATGGCAGATAAGGTTCTACCT	p.Gln147GlufsTer5	frameshift_variant, stop_gained	Exon 3 of 13	1	NM_001098426.2	ENSP00000392617.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: no assertion criteria provided

Submissions by phenotype

Specific granule deficiency 1;C5447331:Autosomal recessive severe congenital neutropenia Pathogenic:1

Jan 01, 2016

Hauner Childrens Hospital, Department of Pediatrics, Dr. von Hauner Children's Hospital; Ludwig Maximilians University

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: in vitro;in vivo;research

- -

Specific granule deficiency 2 Pathogenic:1

May 25, 2017

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.57
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555580263; hg19: chr17-61914560;