rs1555594841

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate

The ENST00000461221.5(BRCA1):​n.*228-46_*307del variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 31)

Consequence

BRCA1
ENST00000461221.5 splice_region, non_coding_transcript_exon

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 2.52

Publications

0 publications found
Variant links:
Genes affected
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]
BRCA1 Gene-Disease associations (from GenCC):
  • breast-ovarian cancer, familial, susceptibility to, 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
  • Fanconi anemia, complementation group S
    Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
  • pancreatic cancer, susceptibility to, 4
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary breast ovarian cancer syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Fanconi anemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PP5
Variant 17-43099797-CTTTTGAGGTTGTATCCGCTGCTTTGTCCTCAGAGTTCTCACAGTTCCAAGGTTAGAGAGTTGGACACTGAGACTGGTTTCCTGCTAAACAGTATGGTAAAGAACAGTCAAGCAATTGTTGGCCAGT-C is Pathogenic according to our data. Variant chr17-43099797-CTTTTGAGGTTGTATCCGCTGCTTTGTCCTCAGAGTTCTCACAGTTCCAAGGTTAGAGAGTTGGACACTGAGACTGGTTTCCTGCTAAACAGTATGGTAAAGAACAGTCAAGCAATTGTTGGCCAGT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 267223.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA1NM_007294.4 linkc.442-43_524del p.Gln148fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 7 of 23 ENST00000357654.9 NP_009225.1 P38398-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA1ENST00000357654.9 linkc.442-43_524del p.Gln148fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 7 of 23 1 NM_007294.4 ENSP00000350283.3 P38398-1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Breast and/or ovarian cancer Pathogenic:1
Mar 15, 2016
CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.5
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555594841; hg19: chr17-41251814; API