rs1555611542

Variant names:

• chr16-89524249-TGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA-T
• rs1555611542
• NM_003119.4:c.618+11_618+68delGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGAGAGTGAGG

Variant summary

Our verdict is Benign. The variant received -11 ACMG points: 1P and 12B. PP3 BP6_Very_Strong BS2

The ENST00000645818.2(SPG7):​c.618+3_618+60delGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000411 in 1,608,672 control chromosomes in the GnomAD database, including 5 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0021 (4 hom., cov: 30)
  • Exomes 𝑓: 0.00023 (1 hom.)
• Consequence: SPG7 ENST00000645818.2 splice_region, intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 9.46
• Publications: 0 publications found

Genes affected

SPG7 (HGNC:11237): (SPG7 matrix AAA peptidase subunit, paraplegin) This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]

SPG7 Gene-Disease associations (from GenCC):

• hereditary spastic paraplegia 7

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
• autosomal dominant optic atrophy

  Inheritance: AD Classification: STRONG Submitted by: PanelApp Australia
• lateral sclerosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -11 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• BP6: Variant 16-89524249-TGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA-T is Benign according to our data. Variant chr16-89524249-TGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA-T is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 215504.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 4 AD,AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000645818.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPG7	NM_003119.4	MANE Select	c.618+11_618+68delGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGAGAGTGAGG		intron	N/A	NP_003110.1	Q9UQ90-1
	SPG7	NM_001363850.1		c.618+11_618+68delGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGAGAGTGAGG		intron	N/A	NP_001350779.1	A0A2R8Y3M4
	SPG7	NM_199367.3		c.618+11_618+68delGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGAGAGTGAGG		intron	N/A	NP_955399.1	Q9UQ90-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPG7	ENST00000645818.2	MANE Select	c.618+3_618+60delGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA		splice_region intron	N/A	ENSP00000495795.2	Q9UQ90-1
	SPG7	ENST00000268704.7	TSL:1	c.618+3_618+60delGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA		splice_region intron	N/A	ENSP00000268704.3	A0A2U3TZH1
	SPG7	ENST00000341316.6	TSL:1	c.618+3_618+60delGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA		splice_region intron	N/A	ENSP00000341157.2	Q9UQ90-2

Frequencies

GnomAD3 genomes AF: 0.00210 AC: 319 AN: 151752 Hom.: 4 Cov.: 30

Gnomad AFR AF: 0.00749

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000460

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00144

GnomAD2 exomes AF: 0.000582 AC: 145 AN: 249300 AF XY: 0.000378

Gnomad AFR exome AF: 0.00871

Gnomad AMR exome AF: 0.0000868

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.000329

GnomAD4 exome AF: 0.000235 AC: 342 AN: 1456802 Hom.: 1 AF XY: 0.000207 AC XY: 150 AN XY: 724144

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00854 AC: 285 AN: 33372

American (AMR) AF: 0.000179 AC: 8 AN: 44678

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26038

East Asian (EAS) AF: 0.00 AC: 0 AN: 39622

South Asian (SAS) AF: 0.0000465 AC: 4 AN: 86064

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52736

Middle Eastern (MID) AF: 0.000416 AC: 2 AN: 4802

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1109348

Other (OTH) AF: 0.000682 AC: 41 AN: 60142

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00210 AC: 319 AN: 151870 Hom.: 4 Cov.: 30 AF XY: 0.00202 AC XY: 150 AN XY: 74244

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00746 AC: 309 AN: 41402

American (AMR) AF: 0.000459 AC: 7 AN: 15242

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5156

South Asian (SAS) AF: 0.00 AC: 0 AN: 4792

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10574

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67930

Other (OTH) AF: 0.00143 AC: 3 AN: 2104

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.000843 Hom.: 0

Asia WGS AF: 0.000577 AC: 2 AN: 3478

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	Hereditary spastic paraplegia 7 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.5
Mutation Taster		=61/39	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555611542; hg19: chr16-89590657;