Our verdict is Benign. Variant got -15 ACMG points: 1P and 16B. PP3BP6_Very_StrongBS1BS2
The ENST00000645818.2(SPG7):c.618+3_618+60delGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000411 in 1,608,672 control chromosomes in the GnomAD database, including 5 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).
SPG7 (HGNC:11237): (SPG7 matrix AAA peptidase subunit, paraplegin) This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
BP6
Variant 16-89524249-TGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA-T is Benign according to our data. Variant chr16-89524249-TGAGTGAGGGTGCGGGAGGCCTGTGAGTGAGGGTGTGGGCACAGGCTGGCAGCCTGTGA-T is described in ClinVar as [Likely_benign]. Clinvar id is 215504.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
BS1
Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0021 (319/151870) while in subpopulation AFR AF= 0.00746 (309/41402). AF 95% confidence interval is 0.00678. There are 4 homozygotes in gnomad4. There are 150 alleles in male gnomad4 subpopulation. Median coverage is 30. This position pass quality control queck.
BS2
High Homozygotes in GnomAd4 at 4 Mitochondrial gene