rs1555618396

Variant names:

• chr17-61859822-G-GCAGAACAAAGTAAGGCTAAGCTTTTTCCACTTCCTGTGGGACTCTCCAACAAACAATGTTGCTTGCTGTTTAATCCTCTGAGAATCTATGAA
• rs1555618396
• NM_032043.3:c.94-7_178dupTTCATAGATTCTCAGAGGATTAAACAGCAAGCAACATTGTTTGTTGGAGAGTCCCACAGGAAGTGGAAAAAGCTTAGCCTTACTTTGTTCTG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_032043.3(BRIP1):​c.94-7_178dupTTCATAGATTCTCAGAGGATTAAACAGCAAGCAACATTGTTTGTTGGAGAGTCCCACAGGAAGTGGAAAAAGCTTAGCCTTACTTTGTTCTG​(p.Ala60ValfsTer8) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A60A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRIP1 NM_032043.3 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.98
• Publications: 1 publications found

Genes affected

BRIP1 (HGNC:20473): (BRCA1 interacting helicase 1) The protein encoded by this gene is a member of the RecQ DEAH helicase family and interacts with the BRCT repeats of breast cancer, type 1 (BRCA1). The bound complex is important in the normal double-strand break repair function of breast cancer, type 1 (BRCA1). This gene may be a target of germline cancer-inducing mutations. [provided by RefSeq, Jul 2008]

BRIP1 Gene-Disease associations (from GenCC):

• familial ovarian cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• Fanconi anemia

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina
• Fanconi anemia complementation group J

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• hereditary breast carcinoma

  Inheritance: AD Classification: STRONG, LIMITED, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• colorectal adenoma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-61859822-G-GCAGAACAAAGTAAGGCTAAGCTTTTTCCACTTCCTGTGGGACTCTCCAACAAACAATGTTGCTTGCTGTTTAATCCTCTGAGAATCTATGAA is Pathogenic according to our data. Variant chr17-61859822-G-GCAGAACAAAGTAAGGCTAAGCTTTTTCCACTTCCTGTGGGACTCTCCAACAAACAATGTTGCTTGCTGTTTAATCCTCTGAGAATCTATGAA is described in ClinVar as Pathogenic. ClinVar VariationId is 407793.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BRIP1	NM_032043.3	c.94-7_178dupTTCATAGATTCTCAGAGGATTAAACAGCAAGCAACATTGTTTGTTGGAGAGTCCCACAGGAAGTGGAAAAAGCTTAGCCTTACTTTGTTCTG	p.Ala60ValfsTer8	frameshift_variant, stop_gained	Exon 3 of 20	ENST00000259008.7	NP_114432.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BRIP1	ENST00000259008.7	c.178_179insTTCATAGATTCTCAGAGGATTAAACAGCAAGCAACATTGTTTGTTGGAGAGTCCCACAGGAAGTGGAAAAAGCTTAGCCTTACTTTGTTCTG	p.Ala60ValfsTer8	frameshift_variant, stop_gained	Exon 3 of 20	1	NM_032043.3	ENSP00000259008.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial cancer of breast;C1836860:Fanconi anemia complementation group J Pathogenic:1

Jul 14, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Ala60Valfs*8) in the BRIP1 gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with BRIP1-related conditions. ClinVar contains an entry for this variant (Variation ID: 407793). Loss-of-function variants in BRIP1 are known to be pathogenic (PMID: 16116423, 17033622, 21964575). For these reasons, this variant has been classified as Pathogenic.

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.0
Mutation Taster		=6/194	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555618396; hg19: chr17-59937183;