rs1555618396
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_032043.3(BRIP1):c.94-7_178dupTTCATAGATTCTCAGAGGATTAAACAGCAAGCAACATTGTTTGTTGGAGAGTCCCACAGGAAGTGGAAAAAGCTTAGCCTTACTTTGTTCTG(p.Ala60ValfsTer8) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A60A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_032043.3 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- familial ovarian cancerInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- Fanconi anemiaInheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina
- Fanconi anemia complementation group JInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- hereditary breast carcinomaInheritance: AD Classification: STRONG, LIMITED, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- colorectal adenomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| BRIP1 | NM_032043.3 | c.94-7_178dupTTCATAGATTCTCAGAGGATTAAACAGCAAGCAACATTGTTTGTTGGAGAGTCCCACAGGAAGTGGAAAAAGCTTAGCCTTACTTTGTTCTG | p.Ala60ValfsTer8 | frameshift_variant, stop_gained | Exon 3 of 20 | ENST00000259008.7 | NP_114432.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| BRIP1 | ENST00000259008.7 | c.178_179insTTCATAGATTCTCAGAGGATTAAACAGCAAGCAACATTGTTTGTTGGAGAGTCCCACAGGAAGTGGAAAAAGCTTAGCCTTACTTTGTTCTG | p.Ala60ValfsTer8 | frameshift_variant, stop_gained | Exon 3 of 20 | 1 | NM_032043.3 | ENSP00000259008.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Familial cancer of breast;C1836860:Fanconi anemia complementation group J Pathogenic:1
This sequence change creates a premature translational stop signal (p.Ala60Valfs*8) in the BRIP1 gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with BRIP1-related conditions. ClinVar contains an entry for this variant (Variation ID: 407793). Loss-of-function variants in BRIP1 are known to be pathogenic (PMID: 16116423, 17033622, 21964575). For these reasons, this variant has been classified as Pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at