rs1555623833

Variant names:

• chr16-89919802-TACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCGACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGAGCGCGGTGCACGCGGCTTTAAGTGTGCTGGGCAGAGGGAGGTGGTGATATTGTGTGGTCTGGTTCCTGTGTGACCCTGGGCAGTTCCTTACCTCCCTGGTCCCCGTTTGTCAAAGAGGATGGACTAAATGATCTCTGAAAGTGTTGAAGCGCGGACCCTTCTGGGTCCAGGGAGGGGTCCCTGCAAAACTCCAGGCAGGACTTCTCACCAGCAGTCGTGGGGAACGGAGGAGGACATGGGGAGGTTGTGGGGCCTCAGGCTCCGGGCACCAGGGGCCAACCTCAGGCTCCTAAAGAGACATTTTCCGCCCACTCCTGGGACACTCCGTCTGCTCCAATGACTGAGCAGCATCCACCCCACCCCATCTTTGCTGCCAGCTCTCAGGACCGTGCCCTCGTCAGCTGGGATGTGAAGTCTCTGGGTGGAAGTGTGTGCCAAGAGCTACTCCCACAGCAGCCCCAGGAGAAGGGGCTTTGTGACCAGAAAGCTTCATCCACAGCCTTGCAGCGGCTCCTGCAAAAGGAGGTGAAATCCCTGCCTCAGGCCAAGGGACCAGGTTTGCAGGAGCCCCCCTAGTGGTATGGGGCTGA-T
• rs1555623833
• ENST00000556922.1:c.545_1098+65del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000556922.1(ENSG00000198211):​c.545_1098+65del variant causes a exon loss change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: ENSG00000198211 ENST00000556922.1 exon_loss
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.98
• Publications: 0 publications found

Genes affected

ENSG00000198211 (HGNC:):

MC1R (HGNC:6929): (melanocortin 1 receptor) This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000556922.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MC1R	NM_002386.4	MANE Select	c.545_*590del	p.Tyr182CysfsTer8	frameshift stop_lost	Exon 1 of 1	NP_002377.4
	MC1R	NM_002386.4	MANE Select	c.545_*590del		3_prime_UTR	Exon 1 of 1	NP_002377.4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENSG00000198211	ENST00000556922.1	TSL:2	c.545_1098+65del		exon_loss	Exon 2 of 5	ENSP00000451560.1	A0A0B4J269
	ENSG00000198211	ENST00000556922.1	TSL:2	c.545_1098+65del	p.Tyr182SerfsTer66	frameshift	Exon 2 of 5	ENSP00000451560.1	A0A0B4J269
	MC1R	ENST00000555147.2	TSL:6 MANE Select	c.545_*590del	p.Tyr182CysfsTer8	frameshift stop_lost	Exon 1 of 1	ENSP00000451605.1	Q01726

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Melanoma, cutaneous malignant, susceptibility to, 5 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555623833; hg19: chr16-89986210;