rs1555623833

Variant names:

• chr16-89919802-TACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCGACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGAGCGCGGTGCACGCGGCTTTAAGTGTGCTGGGCAGAGGGAGGTGGTGATATTGTGTGGTCTGGTTCCTGTGTGACCCTGGGCAGTTCCTTACCTCCCTGGTCCCCGTTTGTCAAAGAGGATGGACTAAATGATCTCTGAAAGTGTTGAAGCGCGGACCCTTCTGGGTCCAGGGAGGGGTCCCTGCAAAACTCCAGGCAGGACTTCTCACCAGCAGTCGTGGGGAACGGAGGAGGACATGGGGAGGTTGTGGGGCCTCAGGCTCCGGGCACCAGGGGCCAACCTCAGGCTCCTAAAGAGACATTTTCCGCCCACTCCTGGGACACTCCGTCTGCTCCAATGACTGAGCAGCATCCACCCCACCCCATCTTTGCTGCCAGCTCTCAGGACCGTGCCCTCGTCAGCTGGGATGTGAAGTCTCTGGGTGGAAGTGTGTGCCAAGAGCTACTCCCACAGCAGCCCCAGGAGAAGGGGCTTTGTGACCAGAAAGCTTCATCCACAGCCTTGCAGCGGCTCCTGCAAAAGGAGGTGAAATCCCTGCCTCAGGCCAAGGGACCAGGTTTGCAGGAGCCCCCCTAGTGGTATGGGGCTGA-T
• rs1555623833
• ENST00000556922.1:c.545_1098+65del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000556922.1(ENSG00000198211):​c.545_1098+65del variant causes a exon loss change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: ENSG00000198211 ENST00000556922.1 exon_loss
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.98
• Publications: 0 publications found

Genes affected

ENSG00000198211 (HGNC:):

MC1R (HGNC:6929): (melanocortin 1 receptor) This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MC1R	NM_002386.4	c.545_*590del	p.Tyr182CysfsTer8	frameshift_variant, stop_lost	Exon 1 of 1	ENST00000555147.2	NP_002377.4
MC1R	NM_002386.4	c.545_*590del		3_prime_UTR_variant	Exon 1 of 1	ENST00000555147.2	NP_002377.4
MC1R		n.89919803_89920802del		bidirectional_gene_fusion
ENSG00000198211		n.89919803_89920802del		bidirectional_gene_fusion

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ENSG00000198211	ENST00000556922.1	c.545_1098+65del		exon_loss_variant	Exon 2 of 5	2		ENSP00000451560.1
ENSG00000198211	ENST00000556922.1	c.545_1098+65del	p.Tyr182SerfsTer66	frameshift_variant	Exon 2 of 5	2		ENSP00000451560.1
MC1R	ENST00000555147.2	c.545_*590del	p.Tyr182CysfsTer8	frameshift_variant, stop_lost	Exon 1 of 1	6	NM_002386.4	ENSP00000451605.1
MC1R	ENST00000555147.2	c.545_*590del		3_prime_UTR_variant	Exon 1 of 1	6	NM_002386.4	ENSP00000451605.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Melanoma, cutaneous malignant, susceptibility to, 5 Uncertain:1

Nov 19, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is a gross deletion of the MC1R single exon gene (c.544_*590del), and encompasses ~40% of the coding sequence. While this deletion is not anticipated to result in nonsense mediated decay, it is expected to create a truncated protein product. This variant has not been reported in the literature in individuals with MC1R-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555623833; hg19: chr16-89986210;