rs1555623833

Positions:

• chr16-89919802-TACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCGACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGAGCGCGGTGCACGCGGCTTTAAGTGTGCTGGGCAGAGGGAGGTGGTGATATTGTGTGGTCTGGTTCCTGTGTGACCCTGGGCAGTTCCTTACCTCCCTGGTCCCCGTTTGTCAAAGAGGATGGACTAAATGATCTCTGAAAGTGTTGAAGCGCGGACCCTTCTGGGTCCAGGGAGGGGTCCCTGCAAAACTCCAGGCAGGACTTCTCACCAGCAGTCGTGGGGAACGGAGGAGGACATGGGGAGGTTGTGGGGCCTCAGGCTCCGGGCACCAGGGGCCAACCTCAGGCTCCTAAAGAGACATTTTCCGCCCACTCCTGGGACACTCCGTCTGCTCCAATGACTGAGCAGCATCCACCCCACCCCATCTTTGCTGCCAGCTCTCAGGACCGTGCCCTCGTCAGCTGGGATGTGAAGTCTCTGGGTGGAAGTGTGTGCCAAGAGCTACTCCCACAGCAGCCCCAGGAGAAGGGGCTTTGTGACCAGAAAGCTTCATCCACAGCCTTGCAGCGGCTCCTGCAAAAGGAGGTGAAATCCCTGCCTCAGGCCAAGGGACCAGGTTTGCAGGAGCCCCCCTAGTGGTATGGGGCTGA-T

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_002386.4(MC1R):​c.545_*590del variant causes a stop lost, 3 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: MC1R NM_002386.4 stop_lost, 3_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.98

Genes affected

MC1R (HGNC:6929): (melanocortin 1 receptor) This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]

(HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MC1R	NM_002386.4	c.545_*590del		stop_lost, 3_prime_UTR_variant	1/1	ENST00000555147.2	NP_002377.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MC1R	ENST00000555147.2	c.545_*590del		stop_lost, 3_prime_UTR_variant	1/1		NM_002386.4	ENSP00000451605	P1
	ENST00000554623.1			splice_acceptor_variant, non_coding_transcript_exon_variant, intron_variant	2/2	3
MC1R	ENST00000639847.1	c.545_*590del		stop_lost, 3_prime_UTR_variant	3/3	5		ENSP00000492011	P1
MC1R	ENST00000555427.1	c.545_*14del		splice_acceptor_variant, splice_donor_variant, stop_lost, splice_donor_5th_base_variant, 3_prime_UTR_variant, intron_variant	3/4	5		ENSP00000451760

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Melanoma, cutaneous malignant, susceptibility to, 5 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Nov 19, 2017

This variant is a gross deletion of the MC1R single exon gene (c.544_*590del), and encompasses ~40% of the coding sequence. While this deletion is not anticipated to result in nonsense mediated decay, it is expected to create a truncated protein product. This variant has not been reported in the literature in individuals with MC1R-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555623833; hg19: chr16-89986210;