rs1555673890
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_020964.3(EPG5):c.3762_3789dupTATTGAAGGGGAATTGGTGATAAACTCT(p.Ala1264TyrfsTer2) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000274 in 1,461,810 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_020964.3 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 exomes AF: 0.00000401 AC: 1AN: 249544Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 135384
GnomAD4 exome AF: 0.00000274 AC: 4AN: 1461810Hom.: 0 Cov.: 31 AF XY: 0.00000138 AC XY: 1AN XY: 727210
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Vici syndrome Pathogenic:1
This sequence change creates a premature translational stop signal (p.Ala1264Tyrfs*2) in the EPG5 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in EPG5 are known to be pathogenic (PMID: 23222957, 23674064). This variant is present in population databases (no rsID available, gnomAD 0.0009%). This variant has not been reported in the literature in individuals affected with EPG5-related conditions. ClinVar contains an entry for this variant (Variation ID: 466248). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at