rs1555673890

Variant names:

• chr18-45913732-C-CAGAGTTTATCACCAATTCCCCTTCAATA
• rs1555673890
• NM_020964.3:c.3762_3789dupTATTGAAGGGGAATTGGTGATAAACTCT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_020964.3(EPG5):​c.3762_3789dupTATTGAAGGGGAATTGGTGATAAACTCT​(p.Ala1264TyrfsTer2) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000274 in 1,461,810 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
• Consequence: EPG5 NM_020964.3 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.0430
• Publications: 1 publications found

Genes affected

EPG5 (HGNC:29331): (ectopic P-granules 5 autophagy tethering factor) This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]

EPG5 Gene-Disease associations (from GenCC):

• Vici syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 18-45913732-C-CAGAGTTTATCACCAATTCCCCTTCAATA is Pathogenic according to our data. Variant chr18-45913732-C-CAGAGTTTATCACCAATTCCCCTTCAATA is described in ClinVar as Pathogenic. ClinVar VariationId is 466248.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020964.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EPG5	NM_020964.3	MANE Select	c.3762_3789dupTATTGAAGGGGAATTGGTGATAAACTCT	p.Ala1264TyrfsTer2	frameshift stop_gained	Exon 21 of 44	NP_066015.2	Q9HCE0-1
	EPG5	NM_001410859.1		c.3762_3789dupTATTGAAGGGGAATTGGTGATAAACTCT	p.Ala1264TyrfsTer2	frameshift stop_gained	Exon 21 of 44	NP_001397788.1	A0A8Q3SIU6
	EPG5	NM_001410858.1		c.3762_3789dupTATTGAAGGGGAATTGGTGATAAACTCT	p.Ala1264TyrfsTer2	frameshift stop_gained	Exon 21 of 44	NP_001397787.1	A0A8Q3SIJ2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EPG5	ENST00000282041.11	TSL:1 MANE Select	c.3762_3789dupTATTGAAGGGGAATTGGTGATAAACTCT	p.Ala1264TyrfsTer2	frameshift stop_gained	Exon 21 of 44	ENSP00000282041.4	Q9HCE0-1
	EPG5	ENST00000587884.2	TSL:1	n.3762_3789dupTATTGAAGGGGAATTGGTGATAAACTCT		non_coding_transcript_exon	Exon 21 of 45	ENSP00000466990.2	K7ENK5
	EPG5	ENST00000587974.1	TSL:1	n.3797_3824dupTATTGAAGGGGAATTGGTGATAAACTCT		non_coding_transcript_exon	Exon 21 of 24

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000401 AC: 1 AN: 249544 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000883

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1461810 Hom.: 0 Cov.: 31 AF XY: 0.00000138 AC XY: 1 AN XY: 727210

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.00 AC: 0 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53408

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000360 AC: 4 AN: 1111952

Other (OTH) AF: 0.00 AC: 0 AN: 60394

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Vici syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.043
Mutation Taster		=8/192	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555673890; hg19: chr18-43493697;