rs1555741967

Positions:

• chr19-33301463-T-TCAGCTCCAGCACCTTCTGCTGCGTCTC

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP5

The NM_004364.5(CEBPA):​c.925_951dupGAGACGCAGCAGAAGGTGCTGGAGCTG​(p.Leu317_Thr318insGluThrGlnGlnLysValLeuGluLeu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CEBPA NM_004364.5 conservative_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.40

Genes affected

CEBPA (HGNC:1833): (CCAAT enhancer binding protein alpha) This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. Mutation of this gene is associated with acute myeloid leukemia. The use of alternative in-frame non-AUG (GUG) and AUG start codons results in protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the GUG and the first AUG start codons. [provided by RefSeq, Dec 2013]

ENSG00000267727 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_004364.5.
• PP5: Variant 19-33301463-T-TCAGCTCCAGCACCTTCTGCTGCGTCTC is Pathogenic according to our data. Variant chr19-33301463-T-TCAGCTCCAGCACCTTCTGCTGCGTCTC is described in ClinVar as [Pathogenic]. Clinvar id is 17570.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CEBPA	NM_004364.5	c.925_951dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu317_Thr318insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	1/1	ENST00000498907.3	NP_004355.2
CEBPA	NM_001287424.2	c.1030_1056dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu352_Thr353insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	1/1		NP_001274353.1
CEBPA	NM_001287435.2	c.883_909dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu303_Thr304insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	1/1		NP_001274364.1
CEBPA	NM_001285829.2	c.568_594dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu198_Thr199insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	1/1		NP_001272758.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CEBPA	ENST00000498907.3	c.925_951dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu317_Thr318insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	1/1	6	NM_004364.5	ENSP00000427514.1
ENSG00000267727	ENST00000587312.1	n.188_214dupGCTCCAGCACCTTCTGCTGCGTCTCCA		non_coding_transcript_exon_variant	1/2	3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Acute myeloid leukemia Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

May 01, 2003

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555741967; hg19: chr19-33792369;