rs1555741967

Variant names:

• chr19-33301463-T-TCAGCTCCAGCACCTTCTGCTGCGTCTC
• rs1555741967
• NM_004364.5:c.925_951dupGAGACGCAGCAGAAGGTGCTGGAGCTG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP5

The NM_004364.5(CEBPA):​c.925_951dupGAGACGCAGCAGAAGGTGCTGGAGCTG​(p.Leu317_Thr318insGluThrGlnGlnLysValLeuGluLeu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. L317L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: CEBPA NM_004364.5 conservative_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.40
• Publications: 1 publications found

Genes affected

CEBPA (HGNC:1833): (CCAAT enhancer binding protein alpha) This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. Mutation of this gene is associated with acute myeloid leukemia. The use of alternative in-frame non-AUG (GUG) and AUG start codons results in protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the GUG and the first AUG start codons. [provided by RefSeq, Dec 2013]

CEBPA Gene-Disease associations (from GenCC):

• acute myeloid leukemia

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Genomics England PanelApp, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)

ENSG00000267727 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 4 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 10 uncertain in NM_004364.5
• PM4: Nonframeshift variant in NON repetitive region in NM_004364.5.
• PP5: Variant 19-33301463-T-TCAGCTCCAGCACCTTCTGCTGCGTCTC is Pathogenic according to our data. Variant chr19-33301463-T-TCAGCTCCAGCACCTTCTGCTGCGTCTC is described in ClinVar as [Pathogenic]. Clinvar id is 17570.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CEBPA	NM_004364.5	c.925_951dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu317_Thr318insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	Exon 1 of 1	ENST00000498907.3	NP_004355.2
CEBPA	NM_001287424.2	c.1030_1056dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu352_Thr353insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	Exon 1 of 1		NP_001274353.1
CEBPA	NM_001287435.2	c.883_909dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu303_Thr304insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	Exon 1 of 1		NP_001274364.1
CEBPA	NM_001285829.2	c.568_594dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu198_Thr199insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	Exon 1 of 1		NP_001272758.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CEBPA	ENST00000498907.3	c.925_951dupGAGACGCAGCAGAAGGTGCTGGAGCTG	p.Leu317_Thr318insGluThrGlnGlnLysValLeuGluLeu	conservative_inframe_insertion	Exon 1 of 1	6	NM_004364.5	ENSP00000427514.1
ENSG00000267727	ENST00000587312.1	n.188_214dupGCTCCAGCACCTTCTGCTGCGTCTCCA		non_coding_transcript_exon_variant	Exon 1 of 2	3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Acute myeloid leukemia Pathogenic:1

May 01, 2003

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=45/55	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555741967; hg19: chr19-33792369; COSMIC: COSV57197707;