rs1555796939
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The NM_000146.4(FTL):c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_000146.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- hereditary hyperferritinemia with congenital cataractsInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- neuroferritinopathyInheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet, Genomics England PanelApp
- L-ferritin deficiencyInheritance: Unknown, AD Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
- genetic hyperferritinemia without iron overloadInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000146.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FTL | TSL:1 MANE Select | c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC | 5_prime_UTR | Exon 1 of 4 | ENSP00000366525.2 | P02792 | |||
| FTL | c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC | 5_prime_UTR | Exon 1 of 4 | ENSP00000523601.1 | |||||
| FTL | c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC | 5_prime_UTR | Exon 1 of 4 | ENSP00000523597.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at