rs1555796939

Variant names:

• chr19-48965317-GCGGTCCCGCGGGTCTGTCTCTTGCTTCAA-G
• rs1555796939
• NM_000146.4:c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_000146.4(FTL):​c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: FTL NM_000146.4 5_prime_UTR
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 2.19
• Publications: 0 publications found

Genes affected

FTL (HGNC:3999): (ferritin light chain) This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]

FTL Gene-Disease associations (from GenCC):

• hereditary hyperferritinemia with congenital cataracts

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet
• neuroferritinopathy

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
• L-ferritin deficiency

  Inheritance: Unknown, AD Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
• genetic hyperferritinemia without iron overload

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000305635 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 19-48965317-GCGGTCCCGCGGGTCTGTCTCTTGCTTCAA-G is Pathogenic according to our data. Variant chr19-48965317-GCGGTCCCGCGGGTCTGTCTCTTGCTTCAA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 16478.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000146.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FTL	NM_000146.4	MANE Select	c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC		5_prime_UTR	Exon 1 of 4	NP_000137.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FTL	ENST00000331825.11	TSL:1 MANE Select	c.-189_-161delGGTCCCGCGGGTCTGTCTCTTGCTTCAAC		5_prime_UTR	Exon 1 of 4	ENSP00000366525.2
	ENSG00000305635	ENST00000812089.1		n.402_430delTTGAAGCAAGAGACAGACCCGCGGGACCG		non_coding_transcript_exon	Exon 2 of 3
	ENSG00000305635	ENST00000812091.1		n.608_636delTTGAAGCAAGAGACAGACCCGCGGGACCG		non_coding_transcript_exon	Exon 1 of 1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Hereditary hyperferritinemia with congenital cataracts Pathogenic:1

Feb 19, 2013

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2
Mutation Taster		=222/78	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555796939; hg19: chr19-49468574;