rs1555900914

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_001242896.3(DEPDC5):​c.2894_2919delACTGCGACATCTATGGGGACAGGCCC​(p.His965fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 31)

Consequence

DEPDC5
NM_001242896.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 8.52
Variant links:
Genes affected
DEPDC5 (HGNC:18423): (DEP domain containing 5, GATOR1 subcomplex subunit) This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 22-31845103-GAGGCCCACTGCGACATCTATGGGGAC-G is Pathogenic according to our data. Variant chr22-31845103-GAGGCCCACTGCGACATCTATGGGGAC-G is described in ClinVar as [Pathogenic]. Clinvar id is 466477.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
DEPDC5NM_001242896.3 linkc.2894_2919delACTGCGACATCTATGGGGACAGGCCC p.His965fs frameshift_variant 30/43 ENST00000651528.2 NP_001229825.1 O75140-10

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
DEPDC5ENST00000651528.2 linkc.2894_2919delACTGCGACATCTATGGGGACAGGCCC p.His965fs frameshift_variant 30/43 NM_001242896.3 ENSP00000498382.1 O75140-10
ENSG00000285404ENST00000646701.1 linkc.1786+25885_1786+25910delACTGCGACATCTATGGGGACAGGCCC intron_variant ENSP00000496158.1 A0A2R8YF50

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial focal epilepsy with variable foci Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpAug 16, 2022This variant is not present in population databases (gnomAD no frequency). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 466477). This variant has not been reported in the literature in individuals affected with DEPDC5-related conditions. This sequence change creates a premature translational stop signal (p.His965Profs*187) in the DEPDC5 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in DEPDC5 are known to be pathogenic (PMID: 23542697, 23542701). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555900914; hg19: chr22-32241089; API