rs1555900914

Variant names:

• chr22-31845103-GAGGCCCACTGCGACATCTATGGGGAC-G
• rs1555900914
• NM_001242896.3:c.2894_2919delACTGCGACATCTATGGGGACAGGCCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001242896.3(DEPDC5):​c.2894_2919delACTGCGACATCTATGGGGACAGGCCC​(p.His965ProfsTer187) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: DEPDC5 NM_001242896.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.52
• Publications: 0 publications found

Genes affected

DEPDC5 (HGNC:18423): (DEP domain containing 5, GATOR1 subcomplex subunit) This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

DEPDC5 Gene-Disease associations (from GenCC):

• epilepsy, familial focal, with variable foci 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Ambry Genetics, Illumina, G2P
• focal epilepsy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• autosomal dominant epilepsy with auditory features

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal dominant nocturnal frontal lobe epilepsy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial focal epilepsy with variable foci

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Brugada syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ENSG00000285404 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 22-31845103-GAGGCCCACTGCGACATCTATGGGGAC-G is Pathogenic according to our data. Variant chr22-31845103-GAGGCCCACTGCGACATCTATGGGGAC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 466477.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DEPDC5	NM_001242896.3	c.2894_2919delACTGCGACATCTATGGGGACAGGCCC	p.His965ProfsTer187	frameshift_variant	Exon 30 of 43	ENST00000651528.2	NP_001229825.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DEPDC5	ENST00000651528.2	c.2894_2919delACTGCGACATCTATGGGGACAGGCCC	p.His965ProfsTer187	frameshift_variant	Exon 30 of 43		NM_001242896.3	ENSP00000498382.1
ENSG00000285404	ENST00000646701.1	c.1786+25885_1786+25910delACTGCGACATCTATGGGGACAGGCCC		intron_variant	Intron 20 of 20			ENSP00000496158.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial focal epilepsy with variable foci Pathogenic:1

Aug 16, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.His965Profs*187) in the DEPDC5 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in DEPDC5 are known to be pathogenic (PMID: 23542697, 23542701). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with DEPDC5-related conditions. ClinVar contains an entry for this variant (Variation ID: 466477). For these reasons, this variant has been classified as Pathogenic.

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.5
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555900914; hg19: chr22-32241089;