rs1555935486

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP5_Moderate

The NM_000284.4(PDHA1):​c.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG​(p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 23)

Consequence

PDHA1
NM_000284.4 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 0.0580

Publications

0 publications found
Variant links:
Genes affected
PDHA1 (HGNC:8806): (pyruvate dehydrogenase E1 subunit alpha 1) The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PDHA1 Gene-Disease associations (from GenCC):
  • Leigh syndrome
    Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
  • pyruvate dehydrogenase E1-alpha deficiency
    Inheritance: XL, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet, Ambry Genetics
  • Leigh syndrome with leukodystrophy
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_000284.4.
PP5
Variant X-19359529-C-CCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG is Pathogenic according to our data. Variant chrX-19359529-C-CCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 495793.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PDHA1NM_000284.4 linkc.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg disruptive_inframe_insertion Exon 11 of 11 ENST00000422285.7 NP_000275.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PDHA1ENST00000422285.7 linkc.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg disruptive_inframe_insertion Exon 11 of 11 1 NM_000284.4 ENSP00000394382.2

Frequencies

GnomAD3 genomes
Cov.:
23
GnomAD4 exome
Cov.:
29
GnomAD4 genome
Cov.:
23

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Pyruvate dehydrogenase complex deficiency Pathogenic:1
Sep 22, 2016
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Variant summary: The PDHA1 c.1050_1133dup84 (p.Glu351_Arg378dup) variant involves the duplication of a stretch of 84 nucleotides in exon 11. One in silico tool predicts a benign outcome for this variant. The information on allele frequency of this variant in population databases is not available due to the ExAC and ESP do not cover duplication variants of this size. This variant has been reported in two male patients with PDHc deficiency and absent in 100 tested control chromosomes. Taken together, this variant is classified as likely pathogenic until more evidence becomes available.

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.058
Mutation Taster
=40/60
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555935486; hg19: chrX-19377647; API