rs1555935486

Variant names:

• chrX-19359529-C-CCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG
• rs1555935486
• NM_000284.4:c.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP5_Moderate

The NM_000284.4(PDHA1):​c.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG​(p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 23)
• Consequence: PDHA1 NM_000284.4 disruptive_inframe_insertion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.0580
• Publications: 0 publications found

Genes affected

PDHA1 (HGNC:8806): (pyruvate dehydrogenase E1 subunit alpha 1) The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]

PDHA1 Gene-Disease associations (from GenCC):

• Leigh syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• pyruvate dehydrogenase E1-alpha deficiency

  Inheritance: XL, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet, Ambry Genetics
• Leigh syndrome with leukodystrophy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000284.4.
• PP5: Variant X-19359529-C-CCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG is Pathogenic according to our data. Variant chrX-19359529-C-CCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 495793.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PDHA1	NM_000284.4	c.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG	p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg	disruptive_inframe_insertion	Exon 11 of 11	ENST00000422285.7	NP_000275.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PDHA1	ENST00000422285.7	c.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG	p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg	disruptive_inframe_insertion	Exon 11 of 11	1	NM_000284.4	ENSP00000394382.2

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Cov.: 29

GnomAD4 genome Cov.: 23

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Pyruvate dehydrogenase complex deficiency Pathogenic:1

Sep 22, 2016

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: The PDHA1 c.1050_1133dup84 (p.Glu351_Arg378dup) variant involves the duplication of a stretch of 84 nucleotides in exon 11. One in silico tool predicts a benign outcome for this variant. The information on allele frequency of this variant in population databases is not available due to the ExAC and ESP do not cover duplication variants of this size. This variant has been reported in two male patients with PDHc deficiency and absent in 100 tested control chromosomes. Taken together, this variant is classified as likely pathogenic until more evidence becomes available.

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.058
Mutation Taster		=40/60	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555935486; hg19: chrX-19377647;