rs1555935486
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP5_Moderate
The NM_000284.4(PDHA1):c.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG(p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). The gene PDHA1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000284.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Leigh syndromeInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- pyruvate dehydrogenase E1-alpha deficiencyInheritance: XL, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics, Orphanet, G2P
- Leigh syndrome with leukodystrophyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000284.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PDHA1 | MANE Select | c.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG | p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg | disruptive_inframe_insertion | Exon 11 of 11 | NP_000275.1 | P08559-1 | ||
| PDHA1 | c.1164_1247dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG | p.Arg416_Gly417insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg | disruptive_inframe_insertion | Exon 12 of 12 | NP_001166925.1 | P08559-4 | |||
| PDHA1 | c.1071_1154dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG | p.Arg385_Gly386insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg | disruptive_inframe_insertion | Exon 11 of 11 | NP_001166926.1 | P08559-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PDHA1 | TSL:1 MANE Select | c.1050_1133dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG | p.Arg378_Gly379insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg | disruptive_inframe_insertion | Exon 11 of 11 | ENSP00000394382.2 | P08559-1 | ||
| PDHA1 | c.1248_1331dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG | p.Arg444_Gly445insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg | disruptive_inframe_insertion | Exon 13 of 13 | ENSP00000617626.1 | ||||
| PDHA1 | c.1209_1292dupCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG | p.Arg431_Gly432insGlnPheAlaThrAlaAspProGluProProLeuGluGluLeuGlyTyrHisIleTyrSerSerAspProProPheGluValArg | disruptive_inframe_insertion | Exon 12 of 12 | ENSP00000617636.1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 exome Cov.: 29
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.