rs1555967644

Variant names:

• chr22-50079809-GTGAATAACATTTACCACCTATTTCCAGCTCAACAAACATTTGCTGACACCATTCGTGGGAGTGGGGCTGTGGGTGTCAGGCGTCTGCGCGAAGCTCGTGTGAACTCACGTTTATTGCTGATGGGTTCAGGACTAGTTTGCATCCAAACCAAATTAAACACGTAGTGGTCACAGCAAACGTGGAAACAAACAATATCTGAAAGTTGGGAATCTGAAAAACAAGGCAGGAGGGGTTTTCCTTCTTTGAATAATAAAAGAAAAAAGGTAACAGATAAACCACACTTCAGGCCATTCACTAAAAATTATCCTGATTAGGACATAATGGTGGGGAGTCCTGCGTGCTCAGCCCGCTCTCCCCTCTGTGCGGCAAAGGCTGGGCTGGGCAGGAGCTTTACTGTCTGGGGGGCAACCTCGGGGGCCCCTCTCGGTGCCACAACGTCTGTGCGTGGGCACACACACAAGCACACATGGGCACACTGTCTGTCAGCCCCTCCGGCTTTCTCCCTGGCAGAGGCTGCCTGCAAGCTAGACTCACCACATTGGCGTTCCTCCTGGAGAC-G
• rs1555967644
• NM_015166.4:c.298_423+108del

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_015166.4(MLC1):​c.298_423+108del​(p.Val100_Asn141del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). Synonymous variant affecting the same amino acid position (i.e. V100V) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 31)
• Consequence: MLC1 NM_015166.4 conservative_inframe_deletion
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 0.186
• Publications: 0 publications found

Genes affected

MLC1 (HGNC:17082): (modulator of VRAC current 1) The function of this gene product is unknown; however, homology to other proteins suggests that it may be an integral membrane transporter. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

MLC1 Gene-Disease associations (from GenCC):

• megalencephalic leukoencephalopathy with subcortical cysts 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Myriad Women’s Health, G2P, Ambry Genetics
• megalencephalic leukoencephalopathy with subcortical cysts

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 4 uncertain in NM_015166.4
• PM4: Nonframeshift variant in NON repetitive region in NM_015166.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_015166.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MLC1	NM_015166.4	MANE Select	c.298_423+108del	p.Val100_Asn141del	conservative_inframe_deletion	Exon 4 of 12	NP_055981.1	Q15049-1
	MLC1	NM_015166.4	MANE Select	c.298_423+108del		exon_loss	Exon 5 of 12	NP_055981.1	Q15049-1
	MLC1	NM_001376472.1		c.298_423+108del	p.Val100_Asn141del	conservative_inframe_deletion	Exon 4 of 11	NP_001363401.1	Q15049-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MLC1	ENST00000311597.10	TSL:1 MANE Select	c.298_423+108del	p.Val100_Asn141del	conservative_inframe_deletion	Exon 5 of 12	ENSP00000310375.6	Q15049-1
	MLC1	ENST00000395876.6	TSL:1	c.298_423+108del	p.Val100_Asn141del	conservative_inframe_deletion	Exon 5 of 12	ENSP00000379216.2	Q15049-1
	MLC1	ENST00000311597.10	TSL:1 MANE Select	c.298_423+108del		exon_loss	Exon 5 of 12	ENSP00000310375.6	Q15049-1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: not provided

Revision: no classification provided

Pathogenic	VUS	Benign	Condition
-	-	-	Megalencephalic leukoencephalopathy with subcortical cysts 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.19

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555967644; hg19: chr22-50518238;