rs1555967644

Variant names:

• chr22-50079809-GTGAATAACATTTACCACCTATTTCCAGCTCAACAAACATTTGCTGACACCATTCGTGGGAGTGGGGCTGTGGGTGTCAGGCGTCTGCGCGAAGCTCGTGTGAACTCACGTTTATTGCTGATGGGTTCAGGACTAGTTTGCATCCAAACCAAATTAAACACGTAGTGGTCACAGCAAACGTGGAAACAAACAATATCTGAAAGTTGGGAATCTGAAAAACAAGGCAGGAGGGGTTTTCCTTCTTTGAATAATAAAAGAAAAAAGGTAACAGATAAACCACACTTCAGGCCATTCACTAAAAATTATCCTGATTAGGACATAATGGTGGGGAGTCCTGCGTGCTCAGCCCGCTCTCCCCTCTGTGCGGCAAAGGCTGGGCTGGGCAGGAGCTTTACTGTCTGGGGGGCAACCTCGGGGGCCCCTCTCGGTGCCACAACGTCTGTGCGTGGGCACACACACAAGCACACATGGGCACACTGTCTGTCAGCCCCTCCGGCTTTCTCCCTGGCAGAGGCTGCCTGCAAGCTAGACTCACCACATTGGCGTTCCTCCTGGAGAC-G
• rs1555967644
• NM_015166.4:c.298_423+108del

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_015166.4(MLC1):​c.298_423+108del​(p.Val100_Asn141del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MLC1 NM_015166.4 conservative_inframe_deletion
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 0.186

Genes affected

MLC1 (HGNC:17082): (modulator of VRAC current 1) The function of this gene product is unknown; however, homology to other proteins suggests that it may be an integral membrane transporter. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_015166.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MLC1	NM_015166.4	c.298_423+108del	p.Val100_Asn141del	conservative_inframe_deletion	Exon 4 of 12	ENST00000311597.10	NP_055981.1
MLC1	NM_015166.4	c.298_423+108del		exon_loss_variant	Exon 5 of 12	ENST00000311597.10	NP_055981.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MLC1	ENST00000311597.10	c.298_423+108del	p.Val100_Asn141del	conservative_inframe_deletion	Exon 5 of 12	1	NM_015166.4	ENSP00000310375.6
MLC1	ENST00000311597.10	c.298_423+108del		exon_loss_variant	Exon 5 of 12	1	NM_015166.4	ENSP00000310375.6

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Megalencephalic leukoencephalopathy with subcortical cysts 1 Other:1

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555967644; hg19: chr22-50518238;