rs1556056125

Variant names:

• chrX-25013533-C-CGCGGCGGCCGCGGCCGCGGCTGCCGCG
• rs1556056125
• NM_139058.3:c.435_461dupCGCGGCAGCCGCGGCCGCGGCCGCCGC

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP5

The NM_139058.3(ARX):​c.435_461dupCGCGGCAGCCGCGGCCGCGGCCGCCGC​(p.Ala146_Ala154dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 21)
• Consequence: ARX NM_139058.3 disruptive_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 3.30

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_139058.3.
• PP5: Variant X-25013533-C-CGCGGCGGCCGCGGCCGCGGCTGCCGCG is Pathogenic according to our data. Variant chrX-25013533-C-CGCGGCGGCCGCGGCCGCGGCTGCCGCG is described in ClinVar as [Pathogenic]. Clinvar id is 29963.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ARX	NM_139058.3	c.435_461dupCGCGGCAGCCGCGGCCGCGGCCGCCGC	p.Ala146_Ala154dup	disruptive_inframe_insertion	Exon 2 of 5	ENST00000379044.5	NP_620689.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ARX	ENST00000379044.5	c.435_461dupCGCGGCAGCCGCGGCCGCGGCCGCCGC	p.Ala146_Ala154dup	disruptive_inframe_insertion	Exon 2 of 5	1	NM_139058.3	ENSP00000368332.4

Frequencies

GnomAD3 genomes Cov.: 21

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 21

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Developmental and epileptic encephalopathy, 1 Pathogenic:1

Aug 01, 2009

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556056125; hg19: chrX-25031650;