rs1556056125
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP5
The NM_139058.3(ARX):c.435_461dupCGCGGCAGCCGCGGCCGCGGCCGCCGC(p.Ala146_Ala154dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. A154A) has been classified as Likely benign.
Frequency
Consequence
NM_139058.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- genetic developmental and epileptic encephalopathyInheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- intellectual disability, X-linked, with or without seizures, ARX-relatedInheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
- Partington syndromeInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- X-linked complex neurodevelopmental disorderInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- X-linked lissencephaly with abnormal genitaliaInheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
- infantile spasmsInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- corpus callosum agenesis-abnormal genitalia syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- infantile epileptic-dyskinetic encephalopathyInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked spasticity-intellectual disability-epilepsy syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARX | NM_139058.3 | MANE Select | c.435_461dupCGCGGCAGCCGCGGCCGCGGCCGCCGC | p.Ala146_Ala154dup | disruptive_inframe_insertion | Exon 2 of 5 | NP_620689.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARX | ENST00000379044.5 | TSL:1 MANE Select | c.435_461dupCGCGGCAGCCGCGGCCGCGGCCGCCGC | p.Ala146_Ala154dup | disruptive_inframe_insertion | Exon 2 of 5 | ENSP00000368332.4 |
Frequencies
GnomAD3 genomes Cov.: 21
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 21
ClinVar
Submissions by phenotype
Developmental and epileptic encephalopathy, 1 Pathogenic:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at