rs1556181091

Variant names:

• chrX-131278026-TCCTTATACAGAGCAAACCCCATGCCTG-T
• rs1556181091
• NM_001555.5:c.2123_2149delCAGGCATGGGGTTTGCTCTGTATAAGG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_001555.5(IGSF1):​c.2123_2149delCAGGCATGGGGTTTGCTCTGTATAAGG​(p.Ala708_Lys716del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 22)
• Consequence: IGSF1 NM_001555.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 5.08
• Publications: 0 publications found

Genes affected

IGSF1 (HGNC:5948): (immunoglobulin superfamily member 1) This gene encodes a member of the immunoglobulin-like domain-containing superfamily. Proteins in this superfamily contain varying numbers of immunoglobulin-like domains and are thought to participate in the regulation of interactions between cells. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]

IGSF1 Gene-Disease associations (from GenCC):

• X-linked central congenital hypothyroidism with late-onset testicular enlargement

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet

ENSG00000287806 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001555.5.
• PP5: Variant X-131278026-TCCTTATACAGAGCAAACCCCATGCCTG-T is Pathogenic according to our data. Variant chrX-131278026-TCCTTATACAGAGCAAACCCCATGCCTG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 39849.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001555.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IGSF1	NM_001555.5	MANE Select	c.2123_2149delCAGGCATGGGGTTTGCTCTGTATAAGG	p.Ala708_Lys716del	disruptive_inframe_deletion	Exon 13 of 20	NP_001546.2
	IGSF1	NM_001170961.2		c.2138_2164delCAGGCATGGGGTTTGCTCTGTATAAGG	p.Ala713_Lys721del	disruptive_inframe_deletion	Exon 13 of 20	NP_001164432.1	Q8N6C5-4
	IGSF1	NM_001438811.1		c.2138_2164delCAGGCATGGGGTTTGCTCTGTATAAGG	p.Ala713_Lys721del	disruptive_inframe_deletion	Exon 14 of 21	NP_001425740.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IGSF1	ENST00000361420.8	TSL:1 MANE Select	c.2123_2149delCAGGCATGGGGTTTGCTCTGTATAAGG	p.Ala708_Lys716del	disruptive_inframe_deletion	Exon 13 of 20	ENSP00000355010.3	Q8N6C5-1
	IGSF1	ENST00000370903.8	TSL:1	c.2138_2164delCAGGCATGGGGTTTGCTCTGTATAAGG	p.Ala713_Lys721del	disruptive_inframe_deletion	Exon 13 of 20	ENSP00000359940.3	Q8N6C5-4
	IGSF1	ENST00000370910.5	TSL:1	c.2096_2122delCAGGCATGGGGTTTGCTCTGTATAAGG	p.Ala699_Lys707del	disruptive_inframe_deletion	Exon 12 of 19	ENSP00000359947.1	Q8N6C5-2

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	X-linked central congenital hypothyroidism with late-onset testicular enlargement (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.1
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1556181091; hg19: chrX-130412000;