rs1556425727

Variant names:

• chr21-45990407-GGTGGACGGCGTGAAGGTGACTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGA-G
• rs1556425727
• NM_001848.3:c.1002+6_1002+88delTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGAAGGTGAC

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 2P and 6B. PVS1_Moderate BP6_Moderate BS1

The ENST00000361866.8(COL6A1):​c.988_1002+68delGTGGACGGCGTGAAGGTGACTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGA​(p.Val330_Lys334del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000132 in 1,294,916 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0036 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00013 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: COL6A1 ENST00000361866.8 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:2 O:1
• Conservation: PhyloP100: 8.34

Genes affected

COL6A1 (HGNC:2211): (collagen type VI alpha 1 chain) The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.014577259 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• BP6: Variant 21-45990407-GGTGGACGGCGTGAAGGTGACTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGA-G is Benign according to our data. Variant chr21-45990407-GGTGGACGGCGTGAAGGTGACTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGA-G is described in ClinVar as [Likely_benign]. Clinvar id is 543025.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr21-45990407-GGTGGACGGCGTGAAGGTGACTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGA-G is described in Lovd as [Likely_benign].
• BS1: Variant frequency is greater than expected in population mid. gnomad4_exome allele frequency = 0.000132 (171/1294916) while in subpopulation MID AF= 0.000597 (3/5024). AF 95% confidence interval is 0.000162. There are 0 homozygotes in gnomad4_exome. There are 78 alleles in male gnomad4_exome subpopulation. This position pass quality control queck.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL6A1	NM_001848.3	c.1002+6_1002+88delTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGAAGGTGAC		splice_region_variant, intron_variant	Intron 13 of 34	ENST00000361866.8	NP_001839.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL6A1	ENST00000361866.8	c.988_1002+68delGTGGACGGCGTGAAGGTGACTGGGGGGAGATAGGATGGACGGGGAGGGACGAGGAGGAATGGGGCGAGATGGGGAGGGACGGA	p.Val330_Lys334del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 13 of 35	1	NM_001848.3	ENSP00000355180.3

Frequencies

GnomAD3 genomes AF: 0.00 AC: 173 AN: 48458 Hom.: 0 Cov.: 0 FAILED QC

Gnomad AFR AF: 0.00400

Gnomad AMI AF: 0.00617

Gnomad AMR AF: 0.00429

Gnomad ASJ AF: 0.00334

Gnomad EAS AF: 0.00202

Gnomad SAS AF: 0.00476

Gnomad FIN AF: 0.00626

Gnomad MID AF: 0.0217

Gnomad NFE AF: 0.00269

Gnomad OTH AF: 0.00318

GnomAD4 exome AF: 0.000132 AC: 171 AN: 1294916 Hom.: 0 AF XY: 0.000121 AC XY: 78 AN XY: 643186

Gnomad4 AFR exome AF: 0.0000347

Gnomad4 AMR exome AF: 0.000101

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000251

Gnomad4 FIN exome AF: 0.0000755

Gnomad4 NFE exome AF: 0.000152

Gnomad4 OTH exome AF: 0.000100

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00357 AC: 173 AN: 48508 Hom.: 0 Cov.: 0 AF XY: 0.00382 AC XY: 89 AN XY: 23292

Gnomad4 AFR AF: 0.00398

Gnomad4 AMR AF: 0.00429

Gnomad4 ASJ AF: 0.00334

Gnomad4 EAS AF: 0.00203

Gnomad4 SAS AF: 0.00476

Gnomad4 FIN AF: 0.00626

Gnomad4 NFE AF: 0.00269

Gnomad4 OTH AF: 0.00311

Alfa AF: 0.000594 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:2 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Bethlem myopathy 1A Benign:1

Jan 23, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Benign:1

Mar 27, 2019

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Ullrich congenital muscular dystrophy 1A;CN029274:Bethlem myopathy 1A Other:1

-

GenomeConnect - Invitae Patient Insights Network

Significance: not provided

Review Status: no classification provided

Collection Method: phenotyping only

Variant interpreted as Likely benign and reported on 03-09-2020 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1556425727; hg19: chr21-47410321;