rs1557109912
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_001256789.3(CACNA1F):c.1433_1463+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG(p.Gly479fs) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. E478E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001256789.3 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Aland island eye diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P
- CACNA1F-related retinopathyInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- congenital stationary night blindness 2AInheritance: XL Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- X-linked cone-rod dystrophy 3Inheritance: XL Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- cone-rod dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- congenital stationary night blindnessInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001256789.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CACNA1F | MANE Select | c.1433_1463+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG | p.Gly479fs | frameshift splice_donor splice_region intron | Exon 11 of 48 | NP_001243718.1 | O60840-2 | ||
| CACNA1F | c.1466_1496+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG | p.Gly490fs | frameshift splice_donor splice_region intron | Exon 11 of 48 | NP_005174.2 | O60840-1 | |||
| CACNA1F | c.1271_1301+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG | p.Gly425fs | frameshift splice_donor splice_region intron | Exon 11 of 48 | NP_001243719.1 | O60840-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CACNA1F | TSL:1 MANE Select | c.1433_1463+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG | p.Gly479fs | frameshift splice_donor splice_region intron | Exon 11 of 48 | ENSP00000321618.6 | O60840-2 | ||
| CACNA1F | TSL:1 | c.1466_1496+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG | p.Gly490fs | frameshift splice_donor splice_region intron | Exon 11 of 48 | ENSP00000365441.2 | O60840-1 | ||
| CACNA1F | TSL:1 | c.1271_1301+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG | p.Gly425fs | frameshift splice_donor splice_region intron | Exon 11 of 48 | ENSP00000365427.1 | O60840-4 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at