rs1557109912

Variant names:

• chrX-49226401-GCCCTCACAGGCAGCGTGTACAGCTGGCCAGAGCCCCCT-G
• rs1557109912
• NM_001256789.3:c.1433_1463+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_001256789.3(CACNA1F):​c.1433_1463+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG​(p.Gly479fs) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 23)
• Consequence: CACNA1F NM_001256789.3 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 4.61

Genes affected

CACNA1F (HGNC:1393): (calcium voltage-gated channel subunit alpha1 F) This gene encodes a multipass transmembrane protein that functions as an alpha-1 subunit of the voltage-dependent calcium channel, which mediates the influx of calcium ions into the cell. The encoded protein forms a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Mutations in this gene can cause X-linked eye disorders, including congenital stationary night blindness type 2A, cone-rod dystropy, and Aland Island eye disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2013]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-49226401-GCCCTCACAGGCAGCGTGTACAGCTGGCCAGAGCCCCCT-G is Pathogenic according to our data. Variant chrX-49226401-GCCCTCACAGGCAGCGTGTACAGCTGGCCAGAGCCCCCT-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 438120.Status of the report is no_assertion_criteria_provided, 0 stars. Variant chrX-49226401-GCCCTCACAGGCAGCGTGTACAGCTGGCCAGAGCCCCCT-G is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CACNA1F	NM_001256789.3	c.1433_1463+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG	p.Gly479fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 48	ENST00000323022.10	NP_001243718.1
CACNA1F	NM_005183.4	c.1466_1496+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG	p.Gly490fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 48		NP_005174.2
CACNA1F	NM_001256790.3	c.1271_1301+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG	p.Gly425fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 48		NP_001243719.1
CACNA1F	XM_011543983.3	c.1271_1301+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG	p.Gly425fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 47		XP_011542285.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CACNA1F	ENST00000323022.10	c.1433_1463+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG	p.Gly479fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 48	1	NM_001256789.3	ENSP00000321618.6
CACNA1F	ENST00000376265.2	c.1466_1496+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG	p.Gly490fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 48	1		ENSP00000365441.2
CACNA1F	ENST00000376251.5	c.1271_1301+7delAGGGGGCTCTGGCCAGCTGTACACGCTGCCTGTGAGGG	p.Gly425fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 48	1		ENSP00000365427.1

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Congenital stationary night blindness Pathogenic:1

Jan 01, 2015

NIHR Bioresource Rare Diseases, University of Cambridge

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557109912; hg19: chrX-49082863;