rs1557134770

Variant names:

• chrX-154030327-TATTCTTGTTGGTTTGCTTTGCAATCCGCTCCGTGTAAAGTCAGCTAACTCTCTCGGTCACGGGCGTCCGGCTGTCCACAGGCTCCTCTCTGTTTGGCCTTGGCATGGAGGATGAAACAATGTCTTTGCGCTCTCCCTCCCCTCGGTGTTTGTACTTTTCTGCGGCCGTGGCGGCGGTGGCAACCGCGGGCTGAGTCTTAGCTGGCTCCTTGGGGCAGCCGTCGCTCTCCAGTGAGCCTCCTCTGGGCATCTTCTCCTCTTTGCAGACGCTGCTGCTCAAGTCCTGGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTG-T
• rs1557134770
• NM_001110792.2:c.1199_*39del

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001110792.2(MECP2):​c.1199_*39del​(p.Pro400fs) variant causes a frameshift, stop lost change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P400P) has been classified as Benign.

• Frequency: Genomes: not found (cov: 23)
• Consequence: MECP2 NM_001110792.2 frameshift, stop_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.67
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.
• PP5: Variant X-154030327-TATTCTTGTTGGTTTGCTTTGCAATCCGCTCCGTGTAAAGTCAGCTAACTCTCTCGGTCACGGGCGTCCGGCTGTCCACAGGCTCCTCTCTGTTTGGCCTTGGCATGGAGGATGAAACAATGTCTTTGCGCTCTCCCTCCCCTCGGTGTTTGTACTTTTCTGCGGCCGTGGCGGCGGTGGCAACCGCGGGCTGAGTCTTAGCTGGCTCCTTGGGGCAGCCGTCGCTCTCCAGTGAGCCTCCTCTGGGCATCTTCTCCTCTTTGCAGACGCTGCTGCTCAAGTCCTGGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTG-T is Pathogenic according to our data. Variant chrX-154030327-TATTCTTGTTGGTTTGCTTTGCAATCCGCTCCGTGTAAAGTCAGCTAACTCTCTCGGTCACGGGCGTCCGGCTGTCCACAGGCTCCTCTCTGTTTGGCCTTGGCATGGAGGATGAAACAATGTCTTTGCGCTCTCCCTCCCCTCGGTGTTTGTACTTTTCTGCGGCCGTGGCGGCGGTGGCAACCGCGGGCTGAGTCTTAGCTGGCTCCTTGGGGCAGCCGTCGCTCTCCAGTGAGCCTCCTCTGGGCATCTTCTCCTCTTTGCAGACGCTGCTGCTCAAGTCCTGGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTG-T is described in ClinVar as [Pathogenic]. Clinvar id is 189664.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1199_*39del	p.Pro400fs	frameshift_variant, stop_lost	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1163_*39del	p.Pro388fs	frameshift_variant, stop_lost	Exon 4 of 4	ENST00000303391.11	NP_004983.1
MECP2	NM_001110792.2	c.1199_*39del		3_prime_UTR_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1163_*39del		3_prime_UTR_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1199_*39del	p.Pro400fs	frameshift_variant, stop_lost	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1163_*39del	p.Pro388fs	frameshift_variant, stop_lost	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6
MECP2	ENST00000453960.7	c.1199_*39del		3_prime_UTR_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1163_*39del		3_prime_UTR_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Rett syndrome Pathogenic:2

Sep 05, 2002

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Mar 18, 2024

Centre for Population Genomics, CPG

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Comparable deletions within the MECP2 deletion-prone region, have been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). PMID 31645986 , PMID: 16473305 This variant is absent from gnomAD (PM2_Supporting). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.7
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1557134770; hg19: chrX-153295778;