rs1557134819

Positions:

• chrX-154030353-CGCTCCGTGTAAAGTCAGCTAACTCTCTCGGTCACGGGCGTCCGGCTGTCCACAGGCTCCTCTCTGTTTGGCCTTGGCATGGAGGATGAAACAATGTCTTTGCGCTCTCCCTCCCCTCGGTGTTTGTACTTTTCTGCGGCCGTGGCGGCGGTGGCAACCGCGGGCTGAGTCTTAGCTGGCTCCTTGGGGCAGCCGTCGCTCTCCAGTGAGCCTCCTCTGGGCATCTTCTCCTCTTTGCAGACGCTGCTGCTCAAGTCCTGGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGGTGGT-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_001110792.2(MECP2):​c.1133_*13del​(p.His378_Ter499delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: MECP2 NM_001110792.2 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 1.98

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1133_*13del	p.His378_Ter499delins???	stop_lost, conservative_inframe_deletion	3/3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1097_*13del	p.His366_Ter487delins???	stop_lost, conservative_inframe_deletion	4/4	ENST00000303391.11	NP_004983.1
MECP2	NM_001110792.2	c.1087_*13del		3_prime_UTR_variant	3/3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1051_*13del		3_prime_UTR_variant	4/4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1133_*13del	p.His378_Ter499delins???	stop_lost, conservative_inframe_deletion	3/3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1097_*13del	p.His366_Ter487delins???	stop_lost, conservative_inframe_deletion	4/4	1	NM_004992.4	ENSP00000301948.6
MECP2	ENST00000453960	c.1087_*13del		3_prime_UTR_variant	3/3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391	c.1051_*13del		3_prime_UTR_variant	4/4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Uncertain significance

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Rett syndrome Pathogenic:1 Uncertain:1

Uncertain significance, criteria provided, single submitter	curation	Centre for Population Genomics, CPG	Jan 12, 2024	This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as a variant of uncertain significance. At least the following criteria are met: At least the following criteria are met: Protein length changes due to in-frame deletions/insertions in a non-repeat region (PM4). At least one individual with this variant has been reported with a clinical phenotype consistent with Rett syndrome (PP4).PMID 11241840 This variant is absent from gnomAD (PM2_Supporting). -
Pathogenic, no assertion criteria provided	curation	RettBASE	Sep 05, 2002	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557134819; hg19: chrX-153295804;