rs1557134946

Positions:

• chrX-154030427-TGGCATGGAGGATGAAACAATGTCTTTGCGCTCTCCCTCCCCTCGGTGTTTGTACTTTTCTGCGGCCGTGGCGGCGGTGGCAACCGCGGGCTGAGTCTTAGCTGGCTCCTTGGGGCAGCCGTCGCTCTCCAGTGAGCCTCCTCTGGGCATCTTCTCCTCTTTGCAGACGCTGCTGCTCAAGTCCTGGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGG-T

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_001110792.2(MECP2):​c.1197_1436del​(p.Pro400_Pro479del) variant causes a inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: MECP2 NM_001110792.2 inframe_deletion
• Clinical Significance: Uncertain significance reviewed by expert panel P:1 U:3
• Conservation: PhyloP100: 7.74

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1197_1436del	p.Pro400_Pro479del	inframe_deletion	3/3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1161_1400del	p.Pro388_Pro467del	inframe_deletion	4/4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000303391.11	c.1161_1400del	p.Pro388_Pro467del	inframe_deletion	4/4	1	NM_004992.4	ENSP00000301948	P1
MECP2	ENST00000453960.7	c.1197_1436del	p.Pro400_Pro479del	inframe_deletion	3/3	1	NM_001110792.2	ENSP00000395535
MECP2	ENST00000407218.5			3_prime_UTR_variant	4/4	5		ENSP00000384865
MECP2	ENST00000628176.2	c.*533_*772del		3_prime_UTR_variant	5/5	3		ENSP00000486978

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Uncertain significance

Submissions summary: Pathogenic:1 Uncertain:3

Revision: reviewed by expert panel

Submissions by phenotype

X-linked intellectual disability-psychosis-macroorchidism syndrome Pathogenic:1 Uncertain:1

Pathogenic, no assertion criteria provided	literature only	OMIM	Dec 01, 2003	- -
Uncertain significance, no assertion criteria provided	curation	RettBASE	Apr 10, 2002	- -

Rett syndrome Uncertain:2

Uncertain significance, reviewed by expert panel	curation	ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel	Oct 13, 2022	The p.Pro400_Pro479del variant in MECP2 (NM_004992.3) causes an in-frame deletion of 80 amino acids, including a deletion of 62 amino acids in a non-repeat region of MECP2. This results in a deletion of greater than 10% of the total protein length (PM4_strong). The variant has been reported to segregate with mild non-syndromic intellectual disability in males in two informative meioses (PMID 11807877) (PP1). In summary, the p.Pro388_Pro467del variant in MECP2 is classified as a Variant of Uncertain Significance based on the ACMG/AMP criteria (PM4_strong, PP1). -
Uncertain significance, criteria provided, single submitter	curation	Centre for Population Genomics, CPG	Mar 13, 2024	This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as a variant of uncertain significance. At least the following criteria are met: Protein length changes due to in-frame deletions/insertions in a non-repeat region (PM4). Co-segregation with disease in multiple affected family members in at least 2 informative meiosis (PP1). PMID: 11807877 This variant is absent from gnomAD (PM2_Supporting). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557134946; hg19: chrX-153295878;