rs1557135251

Variant names:

• chrX-154030617-TCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGG-T
• rs1557135251
• NM_001110792.2:c.1195_1246delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1195_1246delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG​(p.Pro399SerfsTer5) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000025 in 1,199,199 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position has been classified as Uncertain significance. The gene MECP2 is included in the ClinGen Criteria Specification Registry.

• Frequency:
  • Genomes: 𝑓 0.0000095 (0 hom., 1 hem., cov: 16)
  • Exomes 𝑓: 0.0000018 (0 hom. 0 hem.)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 4.53
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, Orphanet, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for MECP2 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 137 pathogenic variants in the truncated region.
• PP5: Variant X-154030617-TCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGG-T is Pathogenic according to our data. Variant chrX-154030617-TCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGG-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 189662.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.1195_1246delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro399SerfsTer5	frameshift	Exon 3 of 3	NP_001104262.1	A0A140VKC4
	MECP2	NM_004992.4	MANE Plus Clinical	c.1159_1210delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro387SerfsTer5	frameshift	Exon 4 of 4	NP_004983.1	D3YJ43
	MECP2	NM_001316337.2		c.880_931delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro294SerfsTer5	frameshift	Exon 5 of 5	NP_001303266.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.1195_1246delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro399SerfsTer5	frameshift	Exon 3 of 3	ENSP00000395535.2	P51608-2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.1159_1210delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro387SerfsTer5	frameshift	Exon 4 of 4	ENSP00000301948.6	P51608-1
	MECP2	ENST00000630151.3	TSL:5	c.1159_1210delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro387SerfsTer5	frameshift	Exon 4 of 4	ENSP00000486089.2	P51608-1

Frequencies

GnomAD3 genomes AF: 0.00000950 AC: 1 AN: 105316 Hom.: 0 Cov.: 16

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000190

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000183 AC: 2 AN: 1093883 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 360941

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 26377

American (AMR) AF: 0.00 AC: 0 AN: 35184

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19370

East Asian (EAS) AF: 0.00 AC: 0 AN: 30164

South Asian (SAS) AF: 0.00 AC: 0 AN: 54123

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 37083

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3985

European-Non Finnish (NFE) AF: 0.00000238 AC: 2 AN: 841599

Other (OTH) AF: 0.00 AC: 0 AN: 45998

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0296732), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000950 AC: 1 AN: 105316 Hom.: 0 Cov.: 16 AF XY: 0.0000348 AC XY: 1 AN XY: 28732

African (AFR) AF: 0.00 AC: 0 AN: 28397

American (AMR) AF: 0.00 AC: 0 AN: 9795

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2580

East Asian (EAS) AF: 0.00 AC: 0 AN: 3384

South Asian (SAS) AF: 0.00 AC: 0 AN: 2320

European-Finnish (FIN) AF: 0.000190 AC: 1 AN: 5262

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 232

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 51286

Other (OTH) AF: 0.00 AC: 0 AN: 1392

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Angelman syndrome (1)
1	-	-	Atypical Rett syndrome (1)
1	-	-	not provided (1)
1	-	-	Rett syndrome (1)
1	-	-	Severe neonatal-onset encephalopathy with microcephaly (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1557135251; hg19: chrX-153296068;