rs1557135251

Positions:

• chrX-154030617-TCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGG-T

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_Strong PM2 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1195_1246delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG​(p.Pro399fs) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000025 in 1,199,199 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.0000095 (0 hom., 1 hem., cov: 16)
  • Exomes 𝑓: 0.0000018 (0 hom. 0 hem.)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 4.53

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.202 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-154030617-TCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGG-T is Pathogenic according to our data. Variant chrX-154030617-TCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 189662.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-154030617-TCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGG-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1195_1246delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro399fs	frameshift_variant	3/3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1159_1210delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro387fs	frameshift_variant	4/4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1195_1246delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro399fs	frameshift_variant	3/3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1159_1210delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG	p.Pro387fs	frameshift_variant	4/4	1	NM_004992.4	ENSP00000301948.6
MECP2	ENST00000407218	c.*531_*582delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG		3_prime_UTR_variant	4/4	5		ENSP00000384865.2
MECP2	ENST00000628176	c.*531_*582delCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCCCTG		3_prime_UTR_variant	5/5	3		ENSP00000486978.1

Frequencies

GnomAD3 genomes AF: 0.00000950 AC: 1 AN: 105316 Hom.: 0 Cov.: 16 AF XY: 0.0000348 AC XY: 1 AN XY: 28732

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000190

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000183 AC: 2 AN: 1093883 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 360941

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000238

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000950 AC: 1 AN: 105316 Hom.: 0 Cov.: 16 AF XY: 0.0000348 AC XY: 1 AN XY: 28732

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000190

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

curation

Centre for Population Genomics, CPG

Mar 15, 2024

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant is absent from gnomAD (PM2_Supporting). Has been observed in at least 2 individuals with phenotypes consistent with MECP2-related disease (PS4_Supporting). ClinVar Variation ID: 189662,PMID 11283202. -

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 08, 2023

This sequence change creates a premature translational stop signal (p.Pro387Serfs*5) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 100 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Angelman syndrome (PMID: 11283202). For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro469Alafs*18) have been determined to be pathogenic (PMID: 32860008). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 189662). This variant is also known as 1230del52. -

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Aug 09, 2023

Previously reported as c.1230del52 in a female patient with a clinical diagnosis of Angelman syndrome (Watson et al., 2001); Frameshift variant predicted to result in protein truncation in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 11283202) -

Angelman syndrome Pathogenic:1

Pathogenic, no assertion criteria provided

curation

RettBASE

Apr 10, 2002

- -

Atypical Rett syndrome Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Apr 01, 2001

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557135251; hg19: chrX-153296068;