rs1557135315

Variant names:

• chrX-154030626-CTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGG-C
• rs1557135315
• NM_001110792.2:c.1137_1237del

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1137_1237del​(p.His379GlnfsTer4) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. H379H) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 17)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 3.50
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 234 pathogenic variants in the truncated region.
• PP5: Variant X-154030626-CTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGG-C is Pathogenic according to our data. Variant chrX-154030626-CTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 189648.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1137_1237del	p.His379GlnfsTer4	frameshift_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1101_1201del	p.His367GlnfsTer4	frameshift_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1137_1237del	p.His379GlnfsTer4	frameshift_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1101_1201del	p.His367GlnfsTer4	frameshift_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 17

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 17

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Pathogenic:3

Jan 11, 2024

Centre for Population Genomics, CPG

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: This variant is absent from gnomAD (PM2_Supporting). Has been observed in in at least 2 individuals with phenotypes consistent with MECP2-related disease (PS4_Supporting).( ClinVar Variation ID: 189648, PMID 10745042‚ 23262346, 12075485). Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). -

Sep 20, 2024

Victorian Clinical Genetics Services, Murdoch Childrens Research Institute

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with MECP2-related disease (OMIM). (I) 0108 - This gene is associated with both recessive and dominant disease. Rett syndrome is inherited in an X-linked dominant pattern, while MECP2-related encephalopathy and intellectual disability demonstrate X-linked recessive inheritance (PMID: 20301670). (I) 0205 - Variant is predicted to result in a truncated protein (premature termination codon is NOT located at least 54 nucleotides upstream of the final exon-exon junction) with less than 1/3 of the protein sequence affected. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0604 - Variant is not located in an established domain, motif, hotspot or informative constraint region. (I) 0701 - Other downstream truncating variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (DECIPHER). (SP) 0802 - This variant has moderate previous evidence of pathogenicity in unrelated individuals. This variant has been reported in three individuals with MECP2-related features, with at least one confirmed de novo (ClinVar, PMIDs: 23262346, 10745042). (SP) 0905 - No published segregation evidence has been identified for this variant. (I) 1007 - No published functional evidence has been identified for this variant. (I) 1203 - This variant has been shown to be de novo in the proband (parental status confirmed) (by trio analysis). (SP) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -

Jun 12, 2013

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Rett syndrome;C0796222:X-linked intellectual disability-psychosis-macroorchidism syndrome;C1846058:Syndromic X-linked intellectual disability Lubs type;C1968556:Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

Jul 03, 2017

Génétique des Maladies du Développement, Hospices Civils de Lyon

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1557135315; hg19: chrX-153296077;