rs1557135317

Variant names:

• chrX-154030626-CTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGGTGGTG-C
• rs1557135317
• NM_001110792.2:c.1132_1237del

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_001110792.2(MECP2):​c.1132_1237del​(p.His378AlafsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 17)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 3.50

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.244 CDS is truncated, and there are 0 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1132_1237del	p.His378AlafsTer8	frameshift_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1096_1201del	p.His366AlafsTer8	frameshift_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1132_1237del	p.His378AlafsTer8	frameshift_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1096_1201del	p.His366AlafsTer8	frameshift_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 17

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 17

ClinVar

Significance: Uncertain significance

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Rett syndrome Pathogenic:1 Uncertain:1

Sep 05, 2002

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Mar 18, 2024

Centre for Population Genomics, CPG

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as likely pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant is absent from gnomAD (PM2_Supporting). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1557135317; hg19: chrX-153296077;