rs1557340558
- chrX-149505034-CCTGTGGTCGAGTTGGCCTGCGTTTCGGATCCGAGGGCGACGCAGACGGAGCTCAGAACCAGACCCAGCCAGAGAAGGCCTCGGCCGGTCCGGGGTGGCGGCATTTCGGCTTCGACGCGGCCGCTTCAGAGCGGCGGGGACAGGCTGCAGCAGGTGGCGCAGTTAGCAGCCGCCGCCGCAGCCACAGAGACCTCCTCGTCGGGAACCCATGAAGACTGCGCAACACAGCCGCCGCCCGGGCCCGCAGGCCCGGGCGCTGGCCGCAGCGCGAGTGCGTCCGTGCGACTCTTCCCTGCGTCCCTCCCCTCCGGGGCGGGTTCT-C
- rs1557340558
- NM_000202.8:c.-217_103del
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate
The NM_000202.8(IDS):c.-217_103del variant causes a 5 prime UTR truncation, exon loss change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_000202.8 5_prime_UTR_truncation, exon_loss
Scores
Clinical Significance
Conservation
Publications
- mucopolysaccharidosis type 2Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp, Myriad Women's Health, ClinGen, Labcorp Genetics (formerly Invitae)
- mucopolysaccharidosis type 2, attenuated formInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- mucopolysaccharidosis type 2, severe formInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000202.8. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| IDS | MANE Select | c.-217_103del | 5_prime_UTR_truncation exon_loss | Exon 1 of 9 | NP_000193.1 | P22304-1 | |||
| IDS | MANE Select | c.-217_103del | exon_loss splice_region | Exon 1 of 9 | NP_000193.1 | P22304-1 | |||
| IDS | c.-443_-124del | 5_prime_UTR_truncation exon_loss | Exon 1 of 9 | NP_001160022.1 | B4DGD7 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| IDS | TSL:1 MANE Select | c.-217_103del | 5_prime_UTR_truncation exon_loss | Exon 1 of 9 | ENSP00000339801.6 | P22304-1 | |||
| IDS | TSL:1 | c.-217_103del | 5_prime_UTR_truncation exon_loss | Exon 1 of 8 | ENSP00000359470.4 | P22304-2 | |||
| IDS | TSL:1 MANE Select | c.-217_103del | exon_loss splice_region | Exon 1 of 9 | ENSP00000339801.6 | P22304-1 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.