rs1567209059
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_005223.4(DNASE1):c.171_226dupCCTGGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACA(p.Asn76ThrfsTer11) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000821 in 1,461,512 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_005223.4 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- syndromic diseaseInheritance: AR Classification: STRONG Submitted by: PanelApp Australia
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005223.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DNASE1 | NM_005223.4 | MANE Select | c.171_226dupCCTGGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACA | p.Asn76ThrfsTer11 | frameshift stop_gained | Exon 3 of 9 | NP_005214.2 | ||
| DNASE1 | NM_001387139.1 | c.171_226dupCCTGGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACA | p.Asn76ThrfsTer11 | frameshift stop_gained | Exon 3 of 9 | NP_001374068.1 | |||
| DNASE1 | NM_001351825.2 | c.171_226dupCCTGGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACA | p.Asn76ThrfsTer11 | frameshift stop_gained | Exon 4 of 10 | NP_001338754.1 | P24855-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DNASE1 | ENST00000246949.10 | TSL:1 MANE Select | c.171_226dupCCTGGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACA | p.Asn76ThrfsTer11 | frameshift stop_gained | Exon 3 of 9 | ENSP00000246949.5 | P24855-1 | |
| DNASE1 | ENST00000407479.5 | TSL:1 | c.171_226dupCCTGGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACA | p.Asn76ThrfsTer11 | frameshift stop_gained | Exon 4 of 10 | ENSP00000385905.1 | P24855-1 | |
| DNASE1 | ENST00000570520.1 | TSL:4 | n.391_446dupCCTGGTCCAGGAGGTCAGAGACAGCCACCTGACTGCCGTGGGGAAGCTGCTGGACA | non_coding_transcript_exon | Exon 3 of 3 |
Frequencies
GnomAD3 genomes AF: 0.000125 AC: 19AN: 152214Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000756 AC: 19AN: 251174 AF XY: 0.0000589 show subpopulations
GnomAD4 exome AF: 0.0000821 AC: 120AN: 1461512Hom.: 0 Cov.: 33 AF XY: 0.0000839 AC XY: 61AN XY: 727074 show subpopulations
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.000125 AC: 19AN: 152332Hom.: 0 Cov.: 32 AF XY: 0.000175 AC XY: 13AN XY: 74486 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at