rs1574349073

Variant names:

• chr2-169509861-ATGAGAAAAAATTCATCGATTGCAC-TGTCA
• rs1574349073
• NM_006063.3:c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_006063.3(KLHL41):​c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA​(p.Asp28ValfsTer7) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KLHL41 NM_006063.3 frameshift, missense
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.60
• Publications: 0 publications found

Genes affected

KLHL41 (HGNC:16905): (kelch like family member 41) This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]

KLHL41 Gene-Disease associations (from GenCC):

• nemaline myopathy 9

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• childhood-onset nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• intermediate nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• typical nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• severe congenital nemaline myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000251569 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 29 pathogenic variants in the truncated region.
• PP5: Variant 2-169509861-ATGAGAAAAAATTCATCGATTGCAC-TGTCA is Pathogenic according to our data. Variant chr2-169509861-ATGAGAAAAAATTCATCGATTGCAC-TGTCA is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 817308.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006063.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KLHL41	NM_006063.3	MANE Select	c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA	p.Asp28ValfsTer7	frameshift missense	Exon 1 of 6	NP_006054.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KLHL41	ENST00000284669.2	TSL:1 MANE Select	c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA	p.Asp28ValfsTer7	frameshift missense	Exon 1 of 6	ENSP00000284669.1	O60662-1
	ENSG00000251569	ENST00000513963.1	TSL:2	c.925-4713_925-4689delATGAGAAAAAATTCATCGATTGCACinsTGTCA		intron	N/A	ENSP00000424363.1	E9PBE3
	KLHL41	ENST00000946624.1		c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA	p.Asp28ValfsTer7	frameshift missense	Exon 1 of 6	ENSP00000616683.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1574349073; hg19: chr2-170366371;