rs1574349073
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_006063.3(KLHL41):c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA(p.Asp28ValfsTer7) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_006063.3 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- nemaline myopathy 9Inheritance: AR Classification: STRONG, MODERATE Submitted by: ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- childhood-onset nemaline myopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- intermediate nemaline myopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- typical nemaline myopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- severe congenital nemaline myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006063.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KLHL41 | NM_006063.3 | MANE Select | c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA | p.Asp28ValfsTer7 | frameshift missense | Exon 1 of 6 | NP_006054.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KLHL41 | ENST00000284669.2 | TSL:1 MANE Select | c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA | p.Asp28ValfsTer7 | frameshift missense | Exon 1 of 6 | ENSP00000284669.1 | O60662-1 | |
| ENSG00000251569 | ENST00000513963.1 | TSL:2 | c.925-4713_925-4689delATGAGAAAAAATTCATCGATTGCACinsTGTCA | intron | N/A | ENSP00000424363.1 | E9PBE3 | ||
| KLHL41 | ENST00000946624.1 | c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA | p.Asp28ValfsTer7 | frameshift missense | Exon 1 of 6 | ENSP00000616683.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at