rs1595158200

Variant names:

• chr14-88385823-ATGGCAGCCGGAGAGGTAAAGGGCAGC-A
• rs1595158200
• NM_018418.5:c.8_19+14delGCAGCCGGAGAGGTAAAGGGCAGCTG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_018418.5(SPATA7):​c.8_19+14delGCAGCCGGAGAGGTAAAGGGCAGCTG​(p.Gly3_Arg6del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000688 in 1,453,414 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 34)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: SPATA7 NM_018418.5 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.94
• Publications: 0 publications found

Genes affected

SPATA7 (HGNC:20423): (spermatogenesis associated 7) This gene, originally isolated from testis, is also expressed in retina. Mutations in this gene are associated with Leber congenital amaurosis and juvenile retinitis pigmentosa. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]

SPATA7 Gene-Disease associations (from GenCC):

• Leber congenital amaurosis 3

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Leber congenital amaurosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• retinitis pigmentosa

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• severe early-childhood-onset retinal dystrophy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000296360 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 14-88385823-ATGGCAGCCGGAGAGGTAAAGGGCAGC-A is Pathogenic according to our data. Variant chr14-88385823-ATGGCAGCCGGAGAGGTAAAGGGCAGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 801396.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SPATA7	NM_018418.5	c.8_19+14delGCAGCCGGAGAGGTAAAGGGCAGCTG	p.Gly3_Arg6del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 1 of 12	ENST00000393545.9	NP_060888.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SPATA7	ENST00000393545.9	c.8_19+14delGCAGCCGGAGAGGTAAAGGGCAGCTG	p.Gly3_Arg6del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 1 of 12	1	NM_018418.5	ENSP00000377176.4

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD2 exomes AF: 0.00 AC: 0 AN: 232708 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.88e-7 AC: 1 AN: 1453414 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 722056

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33454

American (AMR) AF: 0.00 AC: 0 AN: 43740

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25872

East Asian (EAS) AF: 0.0000254 AC: 1 AN: 39418

South Asian (SAS) AF: 0.00 AC: 0 AN: 84478

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52008

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5726

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1108718

Other (OTH) AF: 0.00 AC: 0 AN: 60000

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 34

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

May 28, 2019

Mendelics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.9
Mutation Taster		=8/192	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1595158200; hg19: chr14-88852167;