rs1601945599
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate
The NM_139058.3(ARX):c.1593_1620delCATAGCCGCGCTGAGGCTCAAGGCCAAG(p.Ser531ArgfsTer117) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_139058.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- genetic developmental and epileptic encephalopathyInheritance: AD, XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- intellectual disability, X-linked, with or without seizures, ARX-relatedInheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
- Partington syndromeInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
- X-linked complex neurodevelopmental disorderInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- X-linked lissencephaly with abnormal genitaliaInheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- infantile spasmsInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- corpus callosum agenesis-abnormal genitalia syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- infantile epileptic-dyskinetic encephalopathyInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked spasticity-intellectual disability-epilepsy syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARX | NM_139058.3 | MANE Select | c.1593_1620delCATAGCCGCGCTGAGGCTCAAGGCCAAG | p.Ser531ArgfsTer117 | frameshift | Exon 5 of 5 | NP_620689.1 | Q96QS3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARX | ENST00000379044.5 | TSL:1 MANE Select | c.1593_1620delCATAGCCGCGCTGAGGCTCAAGGCCAAG | p.Ser531ArgfsTer117 | frameshift | Exon 5 of 5 | ENSP00000368332.4 | Q96QS3 | |
| ARX | ENST00000636885.1 | TSL:5 | n.*94_*121delCATAGCCGCGCTGAGGCTCAAGGCCAAG | downstream_gene | N/A |
Frequencies
GnomAD3 genomes Cov.: 24
GnomAD4 genome Cov.: 24
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at