rs193302859

Variant names:

• chr16-1362640-TGAGGATGCTGGCTACTTAAAGACCCCAG-T
• rs193302859
• NM_032520.5:c.640_667delGAGGATGCTGGCTACTTAAAGACCCCAG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_032520.5(GNPTG):​c.640_667delGAGGATGCTGGCTACTTAAAGACCCCAG​(p.Glu214LysfsTer37) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. E214E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: GNPTG NM_032520.5 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1 O:1
• Conservation: PhyloP100: 8.32
• Publications: 4 publications found

Genes affected

GNPTG (HGNC:23026): (N-acetylglucosamine-1-phosphate transferase subunit gamma) This gene encodes the gamma sunbunit of the N-acetylglucosamine-1-phosphotransferase complex. This hexameric complex, composed of alpha, beta and gamma subunits, catalyzes the first step in synthesis of a mannose 6-phosphate lysosomal recognition marker. This enzyme complex is necessary for targeting of lysosomal hydrolases to the lysosome. Mutations in the gene encoding the gamma subunit have been associated with mucolipidosis IIIC, also known as mucolipidosis III gamma.[provided by RefSeq, Feb 2010]

GNPTG Gene-Disease associations (from GenCC):

• GNPTG-mucolipidosis

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Myriad Women’s Health

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-1362640-TGAGGATGCTGGCTACTTAAAGACCCCAG-T is Pathogenic according to our data. Variant chr16-1362640-TGAGGATGCTGGCTACTTAAAGACCCCAG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 2796.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_032520.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GNPTG	NM_032520.5	MANE Select	c.640_667delGAGGATGCTGGCTACTTAAAGACCCCAG	p.Glu214LysfsTer37	frameshift	Exon 9 of 11	NP_115909.1	Q9UJJ9

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GNPTG	ENST00000204679.9	TSL:1 MANE Select	c.640_667delGAGGATGCTGGCTACTTAAAGACCCCAG	p.Glu214LysfsTer37	frameshift	Exon 9 of 11	ENSP00000204679.4	Q9UJJ9
	GNPTG	ENST00000891792.1		c.760_787delGAGGATGCTGGCTACTTAAAGACCCCAG	p.Glu254LysfsTer37	frameshift	Exon 10 of 12	ENSP00000561851.1
	GNPTG	ENST00000529110.2	TSL:2	c.724_751delGAGGATGCTGGCTACTTAAAGACCCCAG	p.Glu242LysfsTer37	frameshift	Exon 8 of 10	ENSP00000435349.2	H0YEA7

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	GNPTG-mucolipidosis (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.3
Mutation Taster		=12/188	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193302859; hg19: chr16-1412641;