rs1977008747

Variant names:

• chr17-8072839-T-TGCGCTGGCGGATGTCGTGTGAGATCTGGTTCAG
• rs1977008747
• NM_001139.3:c.2005_2037dupCTGAACCAGATCTCACACGACATCCGCCAGCGC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_001139.3(ALOX12B):​c.2005_2037dupCTGAACCAGATCTCACACGACATCCGCCAGCGC​(p.Arg679_Asn680insLeuAsnGlnIleSerHisAspIleArgGlnArg) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ALOX12B NM_001139.3 conservative_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.131
• Publications: 0 publications found

Genes affected

ALOX12B (HGNC:430): (arachidonate 12-lipoxygenase, 12R type) This gene encodes an enzyme involved in the conversion of arachidonic acid to 12R-hydroxyeicosatetraenoic acid. Mutations in this gene are associated with nonbullous congenital ichthyosiform erythroderma. [provided by RefSeq, Sep 2015]

ALOX12B Gene-Disease associations (from GenCC):

• autosomal recessive congenital ichthyosis 2

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• congenital non-bullous ichthyosiform erythroderma

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• lamellar ichthyosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• self-healing collodion baby

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001139.3.
• PP5: Variant 17-8072839-T-TGCGCTGGCGGATGTCGTGTGAGATCTGGTTCAG is Pathogenic according to our data. Variant chr17-8072839-T-TGCGCTGGCGGATGTCGTGTGAGATCTGGTTCAG is described in ClinVar as Pathogenic. ClinVar VariationId is 995484.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001139.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ALOX12B	NM_001139.3	MANE Select	c.2005_2037dupCTGAACCAGATCTCACACGACATCCGCCAGCGC	p.Arg679_Asn680insLeuAsnGlnIleSerHisAspIleArgGlnArg	conservative_inframe_insertion	Exon 15 of 15	NP_001130.1	O75342

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ALOX12B	ENST00000647874.1	MANE Select	c.2005_2037dupCTGAACCAGATCTCACACGACATCCGCCAGCGC	p.Arg679_Asn680insLeuAsnGlnIleSerHisAspIleArgGlnArg	conservative_inframe_insertion	Exon 15 of 15	ENSP00000497784.1	O75342
	ALOX12B	ENST00000649809.1		c.1069_1101dupCTGAACCAGATCTCACACGACATCCGCCAGCGC	p.Arg367_Asn368insLeuAsnGlnIleSerHisAspIleArgGlnArg	conservative_inframe_insertion	Exon 8 of 8	ENSP00000496845.1	A0A3B3IRK2
	ALOX12B	ENST00000650441.1		n.428_460dupCTGAACCAGATCTCACACGACATCCGCCAGCGC		non_coding_transcript_exon	Exon 4 of 4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Autosomal recessive congenital ichthyosis 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.13

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1977008747; hg19: chr17-7976157;