rs199473693

Variant names:

• chr1-150553749-CCAGAGCCCAGGCCTCTGGCA-C
• rs199473693
• NM_019032.6:c.767_786delAGGCCTCTGGCACAGAGCCC

Variant summary

Our verdict is Pathogenic. The variant received 15 ACMG points: 16P and 1B. PVS1 PP5_Very_Strong BS2_Supporting

The NM_019032.6(ADAMTSL4):​c.767_786delAGGCCTCTGGCACAGAGCCC​(p.Gln256ProfsTer38) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00176 in 1,613,744 control chromosomes in the GnomAD database, including 2 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. Q256Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.0012 (0 hom., cov: 30)
  • Exomes 𝑓: 0.0018 (2 hom.)
• Consequence: ADAMTSL4 NM_019032.6 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:24 O:2
• Conservation: PhyloP100: 0.968
• Publications: 6 publications found

Genes affected

ADAMTSL4 (HGNC:19706): (ADAMTS like 4) This gene is a member of ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)-like gene family and encodes a protein with seven thrombospondin type 1 repeats. The thrombospondin type 1 repeat domain is found in many proteins with diverse biological functions including cellular adhesion, angiogenesis, and patterning of the developing nervous system. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Sep 2014]

ADAMTSL4-AS2 (HGNC:40895): (ADAMTSL4 antisense RNA 2)

ACMG classification

Our verdict: Pathogenic. The variant received 15 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 1-150553749-CCAGAGCCCAGGCCTCTGGCA-C is Pathogenic according to our data. Variant chr1-150553749-CCAGAGCCCAGGCCTCTGGCA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 39555.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAdExome4 at 2 AR,AD geneVariant has number of homozygotes lower than other variant known as pathogenic in the gene, so the strength is limited to Supporting.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_019032.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ADAMTSL4	NM_019032.6	MANE Select	c.767_786delAGGCCTCTGGCACAGAGCCC	p.Gln256ProfsTer38	frameshift	Exon 6 of 19	NP_061905.2
	ADAMTSL4	NM_001288608.2		c.767_786delAGGCCTCTGGCACAGAGCCC	p.Gln256ProfsTer38	frameshift	Exon 6 of 20	NP_001275537.1	Q6UY14-3
	ADAMTSL4	NM_001378596.1		c.767_786delAGGCCTCTGGCACAGAGCCC	p.Gln256ProfsTer38	frameshift	Exon 6 of 19	NP_001365525.1	Q6UY14-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ADAMTSL4	ENST00000271643.9	TSL:5 MANE Select	c.767_786delAGGCCTCTGGCACAGAGCCC	p.Gln256ProfsTer38	frameshift	Exon 6 of 19	ENSP00000271643.4	Q6UY14-1
	ADAMTSL4	ENST00000369038.6	TSL:1	c.767_786delAGGCCTCTGGCACAGAGCCC	p.Gln256ProfsTer38	frameshift	Exon 4 of 17	ENSP00000358034.2	Q6UY14-1
	ADAMTSL4	ENST00000369039.9	TSL:5	c.767_786delAGGCCTCTGGCACAGAGCCC	p.Gln256ProfsTer38	frameshift	Exon 6 of 20	ENSP00000358035.5	Q6UY14-3

Frequencies

GnomAD3 genomes AF: 0.00118 AC: 180 AN: 151926 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.000194

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000393

Gnomad ASJ AF: 0.000288

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000660

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00231

Gnomad OTH AF: 0.000480

GnomAD2 exomes AF: 0.00121 AC: 303 AN: 250950 AF XY: 0.00116

Gnomad AFR exome AF: 0.000185

Gnomad AMR exome AF: 0.0000868

Gnomad ASJ exome AF: 0.000298

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.000462

Gnomad NFE exome AF: 0.00240

Gnomad OTH exome AF: 0.00131

GnomAD4 exome AF: 0.00182 AC: 2656 AN: 1461700 Hom.: 2 AF XY: 0.00172 AC XY: 1250 AN XY: 727154

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000269 AC: 9 AN: 33480

American (AMR) AF: 0.000112 AC: 5 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.000115 AC: 3 AN: 26130

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.0000580 AC: 5 AN: 86256

European-Finnish (FIN) AF: 0.000880 AC: 47 AN: 53394

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00226 AC: 2514 AN: 1111870

Other (OTH) AF: 0.00121 AC: 73 AN: 60384

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00118 AC: 180 AN: 152044 Hom.: 0 Cov.: 30 AF XY: 0.00104 AC XY: 77 AN XY: 74340

African (AFR) AF: 0.000193 AC: 8 AN: 41458

American (AMR) AF: 0.000392 AC: 6 AN: 15288

Ashkenazi Jewish (ASJ) AF: 0.000288 AC: 1 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5136

South Asian (SAS) AF: 0.00 AC: 0 AN: 4818

European-Finnish (FIN) AF: 0.000660 AC: 7 AN: 10604

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00231 AC: 157 AN: 67962

Other (OTH) AF: 0.000475 AC: 1 AN: 2104

Alfa AF: 0.00174 Hom.: 0

EpiCase AF: 0.00185

EpiControl AF: 0.00178

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
8	-	-	not provided (8)
7	-	-	Ectopia lentis 2, isolated, autosomal recessive (7)
3	-	-	Ectopia lentis et pupillae (5)
3	-	-	Ectopia lentis et pupillae;C3541474:Ectopia lentis 2, isolated, autosomal recessive (3)
1	-	-	Craniosynostosis with ectopia lentis (1)
1	-	-	Ectopia lentis (1)
1	-	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.97
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs199473693; hg19: chr1-150526225;