rs201190482

Variant names:

• chr11-125904265-TCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC-T
• rs201190482
• NM_001330438.2:c.-280+853_-280+890delTCCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCC

Your query was ambiguous. Multiple possible variants found:

• chr11-125904265-TCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC-T
• chr11-125904265-TCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC-TCGCCCCGCTCTCTGCCCTC
• chr11-125904265-TCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC-TCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC
• chr11-125904265-TCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC-TCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001330438.2(DDX25):​c.-280+853_-280+890delTCCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000056 in 339,092 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000047 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000063 (0 hom.)
• Consequence: DDX25 NM_001330438.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.661
• Publications: 0 publications found

Genes affected

DDX25 (HGNC:18698): (DEAD-box helicase 25) DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The encoded protein is a gonadotropin-regulated and developmentally expressed testicular RNA helicase. It may serve to maintain testicular functions related to steroidogenesis and spermatogenesis. [provided by RefSeq, Jul 2008]

DDX25 Gene-Disease associations (from GenCC):

• male infertility with azoospermia or oligozoospermia due to single gene mutation

  Inheritance: AR Classification: MODERATE Submitted by: King Faisal Specialist Hospital and Research Center

DDX25-AS1 (HGNC:58188):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001330438.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DDX25	NM_001330438.2		c.-280+853_-280+890delTCCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCC		intron	N/A	NP_001317367.1	A0A384NYS3
	DDX25	NM_013264.5	MANE Select	c.-252_-215delCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC		upstream_gene	N/A	NP_037396.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DDX25	ENST00000525943.1	TSL:5	c.-280+836_-280+873delCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC		intron	N/A	ENSP00000490224.1	Q9UHL0-2
	DDX25-AS1	ENST00000533033.2	TSL:4	n.395-934_395-897delGAGGGCAGAGAGCGGGGCGGAGGGCAGAGAGCGGGGCG		intron	N/A
	DDX25	ENST00000637851.1	TSL:5	n.-213+836_-213+873delCGCCCCGCTCTCTGCCCTCCGCCCCGCTCTCTGCCCTC		intron	N/A	ENSP00000490392.1	A0A1B0GV69

Frequencies

GnomAD3 genomes AF: 0.0000469 AC: 7 AN: 149180 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000104

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000632 AC: 12 AN: 189806 Hom.: 0 AF XY: 0.0000515 AC XY: 5 AN XY: 97094

African (AFR) AF: 0.000192 AC: 1 AN: 5196

American (AMR) AF: 0.00 AC: 0 AN: 5454

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 6818

East Asian (EAS) AF: 0.00 AC: 0 AN: 17608

South Asian (SAS) AF: 0.00 AC: 0 AN: 1874

European-Finnish (FIN) AF: 0.0000585 AC: 1 AN: 17088

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 964

European-Non Finnish (NFE) AF: 0.0000816 AC: 10 AN: 122558

Other (OTH) AF: 0.00 AC: 0 AN: 12246

GnomAD4 genome AF: 0.0000469 AC: 7 AN: 149286 Hom.: 0 Cov.: 0 AF XY: 0.0000549 AC XY: 4 AN XY: 72828

African (AFR) AF: 0.00 AC: 0 AN: 40300

American (AMR) AF: 0.00 AC: 0 AN: 15092

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3438

East Asian (EAS) AF: 0.00 AC: 0 AN: 4902

South Asian (SAS) AF: 0.00 AC: 0 AN: 4704

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10284

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.000104 AC: 7 AN: 67326

Other (OTH) AF: 0.00 AC: 0 AN: 2046

Alfa AF: 0.00 Hom.: 940

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.66

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs201190482; hg19: chr11-125774160;