rs2084563490

Variant names:

• chr16-2048061-GCGGGGTAAGTGGCGGTCCCCA-G
• rs2084563490
• ENST00000219476.9:c.-33_-30+17delCGGGGTAAGTGGCGGTCCCCA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_000548.5(TSC2):​c.-30+2_-30+22delTAAGTGGCGGTCCCCACGGGG variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000314 in 1,272,410 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000031 (0 hom.)
• Consequence: TSC2 NM_000548.5 splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.28

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

NTHL1 (HGNC:8028): (nth like DNA glycosylase 1) The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.014933628 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.-30+2_-30+22delTAAGTGGCGGTCCCCACGGGG		splice_donor_variant, splice_region_variant, intron_variant	Intron 1 of 41	ENST00000219476.9	NP_000539.2
NTHL1	NM_002528.7	c.-259_-239delTGGGGACCGCCACTTACCCCG		upstream_gene_variant		ENST00000651570.2	NP_002519.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.-33_-30+17delCGGGGTAAGTGGCGGTCCCCA		splice_region_variant	Exon 1 of 42	5	NM_000548.5	ENSP00000219476.3
TSC2	ENST00000219476	c.-33_-30+17delCGGGGTAAGTGGCGGTCCCCA		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 42	5	NM_000548.5	ENSP00000219476.3
TSC2	ENST00000219476.9	c.-33_-30+17delCGGGGTAAGTGGCGGTCCCCA		non_coding_transcript_variant		5	NM_000548.5	ENSP00000219476.3
NTHL1	ENST00000651570.2	c.-259_-239delTGGGGACCGCCACTTACCCCG		upstream_gene_variant			NM_002528.7	ENSP00000498421.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000314 AC: 4 AN: 1272410 Hom.: 0 AF XY: 0.00000323 AC XY: 2 AN XY: 618642

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000389

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Tuberous sclerosis 2 Uncertain:1

Jan 11, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change falls in intron 1 of the TSC2 gene. It does not directly change the encoded amino acid sequence of the TSC2 protein. It affects a nucleotide within the consensus splice site. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. ClinVar contains an entry for this variant (Variation ID: 2730611). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2084563490; hg19: chr16-2098062;